- Clone
- QA17A16 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Leu-19, NKH1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TTCGCCGCATTGAGT
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 392421 | 10 µg | $369.00 | |||
CD56 is a single transmembrane glycoprotein also known as NCAM (Neural Cell Adhesion Molecule), Leu-19, or NKH1. It is a member of the Ig superfamily. The 140 kD isoform is expressed on NK cells and NK-T cells. CD56 is also expressed in the brain (cerebellum and cortex) and at neuromuscular junctions. Certain large granular lymphocyte (LGL) leukemias, small-cell lung carcinomas, neuronal derived tumors, myelomas, and myeloid leukemias also express CD56. CD56 plays a role in homophilic and heterophilic adhesion via binding to itself or heparin sulfate.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Recombinant
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. - Product Citations
-
- RRID
-
AB_2734445 (BioLegend Cat. No. 392421)
Antigen Details
- Structure
- Ig superfamily, single transmembrane or GPI-anchored glycoprotein
- Distribution
-
NK cells, NK-Tcells, brain and neuromuscular junctions, certain large granular lymphocyte (LGL) leukemias, small-cell lung carinomas, neuronal derived tumors, myelomas, and myeloid leukemias
- Function
- Adhesion
- Ligand/Receptor
- Heparin sulfate
- Cell Type
- Leukemia, Neurons, NK cells, NKT cells
- Biology Area
- Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Lanier L, et al. 1991. J. Immunol. 146:4421.
2. Hemperly J, et al. 1990. J. Mol. Neurosci. 2:71.
3. Cremer H, et al. 1994. Nature 367:455. - Gene ID
- 4684 View all products for this Gene ID
- UniProt
- View information about CD56 on UniProt.org
Other Formats
View All CD56 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with purifie... 
-
PE anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were satined with APC CD3... 
-
APC anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Alexa Fluor® 700 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
APC/Fire™ 750 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were satined with FITC CD... -
PE/Dazzle™ 594 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were satined with FITC CD... -
FITC anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD3 Per... -
PE/Cyanine7 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with FITC CD... -
Pacific Blue™ anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD3 Per... -
TotalSeq™-A0084 anti-human CD56 (NCAM) Recombinant Antibody
-
PerCP/Cyanine5.5 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
TotalSeq™-B0084 anti-human CD56 (NCAM) Recombinant Antibody
-
TotalSeq™-C0084 anti-human CD56 (NCAM) Recombinant Antibody
-
PE/Fire™ 700 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark YG™ 581 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 640 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD3 APC... -
PE anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
APC/Fire™ 750 anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
APC anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
FITC anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
PerCP/Cyanine5.5 anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
PE/Cyanine7 anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
Pacific Blue™ anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
PE/Dazzle™ 594 anti-human CD56
Typical results from human peripheral blood lymphocytes stai... -
Spark Red™ 718 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 810 anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark PLUS UV395™ anti-human CD56 (NCAM) Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu...