TotalSeq™-A0093 anti-mouse CD19 Antibody

Pricing & Availability
Clone
6D5 (See other available formats)
Regulatory Status
RUO
Other Names
B4
Isotype
Rat IgG2a, κ
Barcode Sequence
ATCAGCCATGTCAGT
Compare all formats
Cat # Size Price Quantity Check Availability
115559 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD19 is a 95 kD glycoprotein also known as B4. It is a member of the Ig superfamily, expressed on all pro-B to mature B cells (during development) and follicular dendritic cells. Plasma cells do not express CD19. CD19, in association with CD21 and CD81, forms a molecular complex integral to B cell activation.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse CD19-expressing K562 human erythroleukemia cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunofluorescence7.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Shoham T, et al. 2003. J. Immunol. 171:4062. (FC)
  2. Goodyear CS, et al. 2004. J. Immunol. 172:2870. (FC)
  3. Kamimura D, et al. 2006. J. Immunol. 177:306. (FC)
  4. Andoniou CE, et al. 2005. Nat. Immunol. 6:1011. (FC)
  5. Lawson BR, et al. 2007. J. Immunol. 178:5366. (FC)
  6. Phan TG, et al. 2007. Nat. Immunol. 8:992. (FC)
  7. Hayashida K, et al. 2008. J. Biol. Chem. 283:19895. (IF) PubMed
  8. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  9. Bankoti J, et al. 2010. Toxicol. Sci. 115:422. (FC) PubMed
  10. Stadnisky MD, et al. 2011. Blood. 117:5133. (FC) PubMed
  11. Perlot T, et al. 2012. J. Immunol. 188:1201. (FC) PubMed
  12. Olive V, et al. 2013. Elife. 2:822. PubMed
  13. Miyai T, et al. 2014. PNAS. 111:11780. PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  2. Lee RD, et al. 2021. Nat Commun. 12:6843. PubMed
RRID
AB_2749981 (BioLegend Cat. No. 115559)

Antigen Details

Structure
Ig superfamily, associates with CD21 and CD81, 95 kD
Distribution

Pro-B cells to mature B cells (during development), follicular dendritic cells

Function
Modulates B cell activation and differentiation
Ligand/Receptor
CD21, CD81, Leu-13
Cell Type
B cells, Dendritic cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Fearon DT. 1993. Curr. Opin. Immunol. 5:341.
2. Krop I, et al. 1996. Eur. J. Immunol. 26:238.
3. Krop I, et al. 1996. J. Immunol. 157:48.
4. Tedder TF, et al. 1994. Immunol. Today 15:437.

Gene ID
12478 View all products for this Gene ID
UniProt
View information about CD19 on UniProt.org

Other Formats

View All CD19 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse CD19 6D5 FC
Biotin anti-mouse CD19 6D5 FC
FITC anti-mouse CD19 6D5 FC
PE anti-mouse CD19 6D5 FC
PE/Cyanine5 anti-mouse CD19 6D5 FC
Purified anti-mouse CD19 6D5 FC,CyTOF®,IHC-F
PE/Cyanine7 anti-mouse CD19 6D5 FC
Alexa Fluor® 488 anti-mouse CD19 6D5 FC
Alexa Fluor® 647 anti-mouse CD19 6D5 FC,IHC-F
Pacific Blue™ anti-mouse CD19 6D5 FC
Alexa Fluor® 700 anti-mouse CD19 6D5 FC
APC/Cyanine7 anti-mouse CD19 6D5 FC
PerCP anti-mouse CD19 6D5 FC
PerCP/Cyanine5.5 anti-mouse CD19 6D5 FC
Alexa Fluor® 594 anti-mouse CD19 6D5 IHC-F,FC
Brilliant Violet 421™ anti-mouse CD19 6D5 FC,IHC-F
Brilliant Violet 570™ anti-mouse CD19 6D5 FC
Brilliant Violet 605™ anti-mouse CD19 6D5 FC
Brilliant Violet 650™ anti-mouse CD19 6D5 FC
Brilliant Violet 785™ anti-mouse CD19 6D5 FC
Brilliant Violet 510™ anti-mouse CD19 6D5 FC
Purified anti-mouse CD19 (Maxpar® Ready) 6D5 FC,CyTOF®
PE/Dazzle™ 594 anti-mouse CD19 6D5 FC
Brilliant Violet 711™ anti-mouse CD19 6D5 FC
APC/Fire™ 750 anti-mouse CD19 6D5 FC
TotalSeq™-A0093 anti-mouse CD19 6D5 PG
Brilliant Violet 750™ anti-mouse CD19 6D5 FC
TotalSeq™-B0093 anti-mouse CD19 6D5 PG
Spark Blue™ 550 anti-mouse CD19 6D5 FC
Spark NIR™ 685 anti-mouse CD19 6D5 FC
TotalSeq™-C0093 anti-mouse CD19 6D5 PG
Ultra-LEAF™ Purified anti-mouse CD19 6D5 FC,CyTOF®,IHC-F
PE/Fire™ 640 anti-mouse CD19 Antibody 6D5 FC
Spark YG™ 581 anti-mouse CD19 6D5 FC
APC/Fire™ 810 anti-mouse CD19 6D5 FC
Spark YG™ 570 anti-mouse CD19 6D5 IHC-F
Spark Blue™ 574 anti-mouse CD19 Antibody 6D5 FC
Spark Blue™ 515 anti-mouse CD19 6D5 FC
Spark UV™ 387 anti-mouse CD19 6D5 FC
Spark Red™ 718 anti-mouse CD19 (Flexi-Fluor™) 6D5 FC
Go To Top Version: 1    Revision Date: 07/13/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account