TotalSeq™-A0103 anti-mouse/human CD45R/B220 Antibody

Pricing & Availability
Clone
RA3-6B2 (See other available formats)
Regulatory Status
RUO
Other Names
B220
Isotype
Rat IgG2a, κ
Barcode Sequence
CCTACACCTCATAAT
Cat # Size Price Quantity Check Availability
103263 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45R, also known as B220, is an isoform of CD45. It is a member of the protein tyrosine phosphatase (PTP) family with a molecular weight of approximately 180-240 kD. CD45R is expressed on B cells (at all developmental stages from pro-B cells through mature B cells), activated B cells, and subsets of T and NK cells. CD45R (B220) is also expressed on a subset of abnormal T cells involved in the pathogenesis of systemic autoimmunity in MRL-Faslpr and MRL-Fasgld mice. It plays a critical role in TCR and BCR signaling. The primary ligands for CD45 are galectin-1, CD2, CD3, and CD4. CD45R is commonly used as a pan-B cell marker; however, CD19 may be more appropriate for B cell specificity.

Technical data sheet

Product Details

Verified Reactivity
Mouse, Human
Reported Reactivity
Cat
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Abelson murine leukemia virus-induced pre-B tumor cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone RA3-6B2 has been described to react with an epitope on the extracellular domain of the transmembrane CD45 glycoprotein which is dependent upon the expression of exon A and specific carbohydrate residues. Additional reported applications (for the relevant formats) include: immunoprecipitation1, in vitro and in vivo modulation of B cell responses2-4, immunohistochemistry of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections5,6, and spatial biology (IBEX)14,15.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Coffman RL. 1982. Immunol. Rev. 69:5. (IP)
  2. George A, et al. 1994. J. Immunol. 152:1014. (Activ)
  3. Asensi V, et al. 1989. Immunology 68:204. (Activ)
  4. Domiati-Saad R, et al. 1993. J. Immunol. 151:5936. (Activ)
  5. Hata H, et al. 2004. J. Clin. Invest. 114:582. (IHC)
  6. Monteith CE, et al. 1996. Can. J. Vet. Res. 60:193. (IHC)
  7. Shih FF, et al. 2006. J. Immunol. 176:3438. (FC)
  8. Chang C L-T, et al. 2007. J. Immunol. 178:6984.
  9. Fazilleau N, et al. 2007. Nature Immunol. 8:753.
  10. Lang GL, et al. 2008. Blood 111:2158. PubMed
  11. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  12. del Rio ML, et al. 2011. Transpl. Int. 24:501. (FC) PubMed
  13. Murakami R, et al. 2013. PLoS One. 8:73270. PubMed
  14. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  15. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Lee RD, et al. 2021. Nat Commun. 12:6843. PubMed
  2. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  3. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  4. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2734158 (BioLegend Cat. No. 103263)

Antigen Details

Structure
Protein tyrosine phosphatase (PTP) family, 180-240 kD
Distribution

B cells, T cell subset, NK cell subset

Function
Phosphatase, T and B cell activation
Ligand/Receptor
Galectin-1, CD2, CD3, CD4
Cell Type
B cells, NK cells, T cells
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Trowbridge IS, et al. 1993. Annu. Rev. Immunol. 12:85.
3. Kishihara K, et al. 1993. Cell 74:143.
4. Pulido R, et al. 1988. J. Immunol. 140:3851.

Gene ID
19264 View all products for this Gene ID 5788 View all products for this Gene ID
UniProt
View information about CD45R on UniProt.org

Other Formats

View All CD45R/B220 Reagents Request Custom Conjugation
Description Clone Applications
Alexa Fluor® 594 anti-mouse/human CD45R/B220 RA3-6B2 IHC-F,FC,3D IHC
APC anti-mouse/human CD45R/B220 RA3-6B2 FC
Biotin anti-mouse/human CD45R/B220 RA3-6B2 FC,IHC-F
FITC anti-mouse/human CD45R/B220 RA3-6B2 FC
PE anti-mouse/human CD45R/B220 RA3-6B2 FC
PE/Cyanine5 anti-mouse/human CD45R/B220 RA3-6B2 FC
Purified anti-mouse/human CD45R/B220 RA3-6B2 FC,CyTOF®,IHC-F,IHC-P,IP,Activ
PE/Cyanine7 anti-mouse/human CD45R/B220 RA3-6B2 FC
APC/Cyanine7 anti-mouse/human CD45R/B220 RA3-6B2 FC
Alexa Fluor® 488 anti-mouse/human CD45R/B220 RA3-6B2 FC,IHC-F,3D IHC
Alexa Fluor® 647 anti-mouse/human CD45R/B220 RA3-6B2 FC,IHC-F,3D IHC,SB
Pacific Blue™ anti-mouse/human CD45R/B220 RA3-6B2 FC
Alexa Fluor® 700 anti-mouse/human CD45R/B220 RA3-6B2 FC
PerCP anti-mouse/human CD45R/B220 RA3-6B2 FC
PerCP/Cyanine5.5 anti-mouse/human CD45R/B220 RA3-6B2 FC
Brilliant Violet 421™ anti-mouse/human CD45R/B220 RA3-6B2 FC,IHC-F
Brilliant Violet 570™ anti-mouse/human CD45R/B220 RA3-6B2 FC
Brilliant Violet 650™ anti-mouse/human CD45R/B220 RA3-6B2 FC
Brilliant Violet 605™ anti-mouse/human CD45R/B220 RA3-6B2 FC
Brilliant Violet 785™ anti-mouse/human CD45R/B220 RA3-6B2 FC
Brilliant Violet 510™ anti-mouse/human CD45R/B220 RA3-6B2 FC,IHC-F,SB
Purified anti-mouse/human CD45R/B220 (Maxpar® Ready) RA3-6B2 FC,CyTOF®
Brilliant Violet 711™ anti-mouse/human CD45R/B220 RA3-6B2 FC
PE/Dazzle™ 594 anti-mouse/human CD45R/B220 RA3-6B2 FC
APC/Fire™ 750 anti-mouse/human CD45R/B220 RA3-6B2 FC
Brilliant Violet 750™ anti-mouse/human CD45R/B220 RA3-6B2 FC
TotalSeq™-A0103 anti-mouse/human CD45R/B220 RA3-6B2 PG
Spark Blue™ 550 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark NIR™ 685 anti-mouse/human CD45R/B220 RA3-6B2 FC
TotalSeq™-B0103 anti-mouse/human CD45R/B220 RA3-6B2 PG
Ultra-LEAF™ Purified anti-mouse/human CD45R/B220 RA3-6B2 FC,CyTOF®,IHC-F,IHC-P,IP,Activ
TotalSeq™-C0103 anti-mouse/human CD45R/B220 RA3-6B2 PG
PE/Fire™ 640 anti-mouse/human CD45R/B220 RA3-6B2 FC
APC/Fire™ 810 anti-mouse/human CD45R/B220 RA3-6B2 FC
PE/Fire™ 700 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark Violet™ 538 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark YG™ 581 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark YG™ 570 anti-mouse/human CD45R/B220 RA3-6B2 IHC-F
PE/Fire™ 810 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark Blue™ 574 anti-mouse/human CD45R/B220 Antibody RA3-6B2 FC
Spark Violet™ 423 anti-mouse/human CD45R/B220 Antibody RA3-6B2 FC
Spark Red™ 718 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark UV™ 387 anti-mouse/human CD45R/B220 RA3-6B2 FC
Spark PLUS UV395™ anti-mouse/human CD45R/B220 RA3-6B2 FC
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account