- Clone
- RA3-6B2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- B220
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- CCTACACCTCATAAT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
103263 | 10 µg | $369.00 |
CD45R, also known as B220, is an isoform of CD45. It is a member of the protein tyrosine phosphatase (PTP) family with a molecular weight of approximately 180-240 kD. CD45R is expressed on B cells (at all developmental stages from pro-B cells through mature B cells), activated B cells, and subsets of T and NK cells. CD45R (B220) is also expressed on a subset of abnormal T cells involved in the pathogenesis of systemic autoimmunity in MRL-Faslpr and MRL-Fasgld mice. It plays a critical role in TCR and BCR signaling. The primary ligands for CD45 are galectin-1, CD2, CD3, and CD4. CD45R is commonly used as a pan-B cell marker; however, CD19 may be more appropriate for B cell specificity.
Product Details
- Verified Reactivity
- Mouse, Human
- Reported Reactivity
- Cat
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Abelson murine leukemia virus-induced pre-B tumor cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone RA3-6B2 has been described to react with an epitope on the extracellular domain of the transmembrane CD45 glycoprotein which is dependent upon the expression of exon A and specific carbohydrate residues. Additional reported applications (for the relevant formats) include: immunoprecipitation1, in vitro and in vivo modulation of B cell responses2-4, immunohistochemistry of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections5,6, and spatial biology (IBEX)14,15.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Coffman RL. 1982. Immunol. Rev. 69:5. (IP)
- George A, et al. 1994. J. Immunol. 152:1014. (Activ)
- Asensi V, et al. 1989. Immunology 68:204. (Activ)
- Domiati-Saad R, et al. 1993. J. Immunol. 151:5936. (Activ)
- Hata H, et al. 2004. J. Clin. Invest. 114:582. (IHC)
- Monteith CE, et al. 1996. Can. J. Vet. Res. 60:193. (IHC)
- Shih FF, et al. 2006. J. Immunol. 176:3438. (FC)
- Chang C L-T, et al. 2007. J. Immunol. 178:6984.
- Fazilleau N, et al. 2007. Nature Immunol. 8:753.
- Lang GL, et al. 2008. Blood 111:2158. PubMed
- Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
- del Rio ML, et al. 2011. Transpl. Int. 24:501. (FC) PubMed
- Murakami R, et al. 2013. PLoS One. 8:73270. PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- Product Citations
-
- RRID
-
AB_2734158 (BioLegend Cat. No. 103263)
Antigen Details
- Structure
- Protein tyrosine phosphatase (PTP) family, 180-240 kD
- Distribution
-
B cells, T cell subset, NK cell subset
- Function
- Phosphatase, T and B cell activation
- Ligand/Receptor
- Galectin-1, CD2, CD3, CD4
- Cell Type
- B cells, NK cells, T cells
- Biology Area
- Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Trowbridge IS, et al. 1993. Annu. Rev. Immunol. 12:85.
3. Kishihara K, et al. 1993. Cell 74:143.
4. Pulido R, et al. 1988. J. Immunol. 140:3851. - Gene ID
- 19264 View all products for this Gene ID 5788 View all products for this Gene ID
- UniProt
- View information about CD45R on UniProt.org
Other Formats
View All CD45R/B220 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Alexa Fluor® 594 anti-mouse/human CD45R/B220
-
APC anti-mouse/human CD45R/B220
-
Biotin anti-mouse/human CD45R/B220
-
FITC anti-mouse/human CD45R/B220
-
PE anti-mouse/human CD45R/B220
-
PE/Cyanine5 anti-mouse/human CD45R/B220
-
Purified anti-mouse/human CD45R/B220
-
PE/Cyanine7 anti-mouse/human CD45R/B220
-
APC/Cyanine7 anti-mouse/human CD45R/B220
-
Alexa Fluor® 488 anti-mouse/human CD45R/B220
-
Alexa Fluor® 647 anti-mouse/human CD45R/B220
-
Pacific Blue™ anti-mouse/human CD45R/B220
-
Alexa Fluor® 700 anti-mouse/human CD45R/B220
-
PerCP anti-mouse/human CD45R/B220
-
PerCP/Cyanine5.5 anti-mouse/human CD45R/B220
-
Brilliant Violet 421™ anti-mouse/human CD45R/B220
-
Brilliant Violet 570™ anti-mouse/human CD45R/B220
-
Brilliant Violet 650™ anti-mouse/human CD45R/B220
-
Brilliant Violet 605™ anti-mouse/human CD45R/B220
-
Brilliant Violet 785™ anti-mouse/human CD45R/B220
-
Brilliant Violet 510™ anti-mouse/human CD45R/B220
-
Purified anti-mouse/human CD45R/B220 (Maxpar® Ready)
-
Brilliant Violet 711™ anti-mouse/human CD45R/B220
-
PE/Dazzle™ 594 anti-mouse/human CD45R/B220
-
APC/Fire™ 750 anti-mouse/human CD45R/B220
-
Brilliant Violet 750™ anti-mouse/human CD45R/B220
-
TotalSeq™-A0103 anti-mouse/human CD45R/B220
-
Spark Blue™ 550 anti-mouse/human CD45R/B220
-
Spark NIR™ 685 anti-mouse/human CD45R/B220
-
TotalSeq™-B0103 anti-mouse/human CD45R/B220
-
Ultra-LEAF™ Purified anti-mouse/human CD45R/B220
-
TotalSeq™-C0103 anti-mouse/human CD45R/B220
-
PE/Fire™ 640 anti-mouse/human CD45R/B220
-
APC/Fire™ 810 anti-mouse/human CD45R/B220
-
PE/Fire™ 700 anti-mouse/human CD45R/B220
-
Spark Violet™ 538 anti-mouse/human CD45R/B220
-
Spark YG™ 581 anti-mouse/human CD45R/B220
-
Spark YG™ 570 anti-mouse/human CD45R/B220
-
PE/Fire™ 810 anti-mouse/human CD45R/B220
-
Spark Blue™ 574 anti-mouse/human CD45R/B220 Antibody
-
Spark Violet™ 423 anti-mouse/human CD45R/B220 Antibody
-
Spark Red™ 718 anti-mouse/human CD45R/B220
-
Spark UV™ 387 anti-mouse/human CD45R/B220
-
Spark PLUS UV395™ anti-mouse/human CD45R/B220