TotalSeq™-A0116 anti-mouse Ly-6G/Ly-6C (Gr-1) Antibody

Pricing & Availability
Clone
RB6-8C5 (See other available formats)
Regulatory Status
RUO
Other Names
Gr-1
Isotype
Rat IgG2b, κ
Barcode Sequence
TAGTGTATGGACACG
Compare all formats
Cat # Size Price Quantity Check Availability
108459 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Gr-1 is a 21-25 kD protein also known as Ly-6G/Ly-6C. This myeloid differentiation antigen is a glycosylphosphatidylinositol (GPI)-linked protein expressed on granulocytes and macrophages. In bone marrow, the expression levels of Gr-1 directly correlate with granulocyte differentiation and maturation; Gr-1 is also transiently expressed on bone marrow cells in the monocyte lineage. Immature Myeloid Gr-1+ cells play a role in the development of antitumor immunity.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Raised against granulocytes of mouse origin
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone RB6-8C5 binds with high affinity to mouse Ly-6G molecules and to a lower extent to Ly-6C19. Clone RB6-8C5 impairs the binding of anti-mouse Ly-6G clone 1A819. However, clone RB6-8C5 is able to stain in the presence of anti-mouse Ly-6C clone HK1.420.

The RB6-8C5 antibody has been used to identify peripheral blood neutrophils and deplete granulocytes in vivo. Additional reported applications (for relevant formats of this clone) include: in vitro complement-mediated cytotoxicity2, in vivo depletion3-5,9, immunoprecipitation1, immunohistochemical staining6 (including paraffin-embedded sections9,16,33-35, acetone-fixed frozen sections11 and zinc-fixed sections15), and Western blotting7. RB6-8C5 is not suitable for depletion of hepatic myeloid derived suppressor cells (MDSCs)20.

Special Note: For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 108436).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Fleming TJ, et al. 1993. J. Immunol. 151:2399. (IP)
  2. Brummer E, et al. 1984. J. Leukocyte Biol. 36:505. (CMCD)
  3. Stoppacciaro A, et al. 1993. J. Exp. Med. 178:151. (Deplete)
  4. Tumpey TM, et al. 1996. J. Virol. 70:898. (Deplete)
  5. Czuprynski CJ, et al. 1994. J. Immunol. 152:1836. (Deplete)
  6. Nitta H, et al. 1997. Cell Vision 4:73. (IHC)
  7. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819. (WB)
  8. Engwerda CR, et al. 2004. Am. J. Pathol. 165:2123.
  9. Brown CR, et al. 2004. Infect. Immun. 72:4956. (Deplete, IHC)
  10. Andoniou CE, et al. 2005. Nature Immunology 6:1011. (FC) PubMed
  11. Li M, et al. 2006. P. Natl. Acad. Sci USA 103:11736. (IHC)
  12. Dzhagalov I, et al. 2007. Blood 109:1620. (FC) PubMed
  13. Fazilleau N, et al. 2007. Nature Immunol. 8:753. (FC) PubMed
  14. Heuser M, et al. 2007. Blood 110:1639. (FC) PubMed
  15. Wang T, et al. 2007. Infect. Immun. 75:1144. (IHC)
  16. Bosio CM, et al. 2007. J. Immunol. 178:4538. (IHC)
  17. Boehme SA, et al. 2009. Int. Immunol. 21:81. (IHC)
  18. Piao Y, et al. 2012. Neuro Oncol. 14:1379. PubMed
  19. Ribechini E, et al. 2009. Eur. J. Immunol. 39:3538.
  20. Ma C, et al. 2012. J. Leukoc. Biol. 92:1199.
  21. Li J, et al. 2012. Arthritis Rheum. 64:1098. PubMed
  22. Fan Q, et al. 2014. Cancer Res. 74:471. PubMed
  23. Korrer MJ, et al. 2014. PLoS One. 9:91370. PubMed
  24. Morshed M, et al. 2014. J Immunol. 192:5314. PubMed
  25. Collins C, et al. 2014. PNAS. 111:9899. PubMed
  26. Madireddi S, et al. 2014. J Exp Med. 211:1433. PubMed
  27. Bianchi G, et al. 2014. Cell Death Dis. 5:1135. PubMed
  28. Guo H, et al. 2014. J Leukoc Biol. 96:419. PubMed
  29. Roderick JE, et al. 2014. PNAS. 111:14436. PubMed
  30. Distel E, et al. 2014. Circ Res. 115:759. PubMed
  31. Iwai H, et al. 2015. Tuberculosis. 95:246. PubMed
  32. Charmsaz S, et al. 2015. PLoS One. 10:130692. PubMed
  33. Whiteland J, et al. 1994 J Histochem Cytochem 43:3 (IHC-P)
  34. Brown C, et al. 2003 J Immunology 171:2 (IHC-P)
  35. Obregon-Henao A, et al. PLoS One 8:11 (IHC-P)
Product Citations
  1. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2783050 (BioLegend Cat. No. 108459)

Antigen Details

Structure
21-25 kD
Distribution

Granulocytes, monocytes

Cell Type
Granulocytes, Monocytes, Neutrophils
Biology Area
Immunology, Innate Immunity
Antigen References

1. Fleming TJ, et al. 1993. J. Immunol. 151:2399.
2. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819.
3. Goni O, et al. 2002. Int. Immunol. 14:1125.

Gene ID
17067 View all products for this Gene ID 546644 View all products for this Gene ID
UniProt
View information about Ly-6G Ly-6C on UniProt.org

Other Formats

View All Ly-6G/Ly-6C Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Biotin anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC,IHC,IP,WB
FITC anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
PE anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
PE/Cyanine5 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Purified anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC,IHC,IP,WB
PE/Cyanine7 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Alexa Fluor® 488 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC,IHC
Alexa Fluor® 647 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC,SB
Alexa Fluor® 700 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Brilliant Violet 711™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
APC/Cyanine7 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Pacific Blue™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
PerCP/Cyanine5.5 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
PerCP anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Brilliant Violet 421™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Brilliant Violet 570™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Ultra-LEAF™ Purified anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC,IP,CMCD,Depletion,IHC,WB
Brilliant Violet 510™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Brilliant Violet 605™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Brilliant Violet 650™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Alexa Fluor® 594 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 IHC-F,FC
Purified anti-mouse Ly-6G/Ly-6C (Gr-1) (Maxpar® Ready) RB6-8C5 FC,CyTOF®
PE/Dazzle™ 594 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
APC/Fire™ 750 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
TotalSeq™-A0116 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 PG
TotalSeq™-C0116 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 PG
TotalSeq™-B0116 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 PG
Spark Blue™ 550 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
APC/Fire™ 810 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Spark Violet™ 423 anti-mouse Ly-6G/Ly-6C (GR-1) Antibody RB6-8C5 FC
Spark UV™ 387 anti-mouse Ly-6G/Ly-6C (GR-1) RB6-8C5 FC
Spark Violet™ 538 anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Spark PLUS UV395™ anti-mouse Ly-6G/Ly-6C (Gr-1) RB6-8C5 FC
Spark Red™ 718 anti-mouse Ly-6G/Ly-6C (Gr-1) (Flexi-Fluor™) RB6-8C5 FC
Spark Blue™ 574 anti-mouse Ly-6G/Ly-6C (Gr-1) (Flexi-Fluor™) RB6-8C5 FC
Go To Top Version: 1    Revision Date: 08/30/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account