TotalSeq™-A0128 anti-human CD140a (PDGFRα) Antibody

Product Details

Verified Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

NIH 3T3 cells transfected with human PDGFRalpha

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Miyazaki S et al. In:Leukocyte Typing VI Kishimoto et al. Eds, Garland Publishing Inc, New York 1998 pp 3-20.
2. Lottaz C, et al. 2010. Cancer Res. 70:2030. PubMed
3. Ricono JM, et al. 2009. Am. J. Physiol. Renal Physiol. 296:F406. (IF)
4. Guarnerio J, et al. 2015. Cancer Discov. 5:396. PubMed

Product Citations

1. Leader AM, et al. 2021. Cancer Cell. 39:1594. PubMed
2. Gomez-Collignon A, et al. 2022. Eur Cell Mater. 43:1. PubMed
3. Hao Y, et al. 2021. Cell. 184:3573. PubMed

RRID

AB_2750354 (BioLegend Cat. No. 323509)

Antigen Details

Structure

Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family.

Distribution

Widely expressed on a variety of mesenchymal-derived cells.

Function

Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Knock-out studies have implicated an essential role for CD140a in kidney development. Has been implicated in basal cell carcinoma and gastric stromal cell tumors.

Interaction

Interacts with Crk, as well as a variety of adaptor molecules and signaling intermediates (Grb2, Grb14, SHP2, others). Has also been shown to associate with integrin β3, caveolin-1, and nexin sorting molecules

Ligand/Receptor

Binds to A-chain containing PDGF molecules and protease-activated PDGF-C molecules

Modification

Multiple tyrosine phosphorylation sites (Y720, Y731, Y742, Y754, Y762, Y767, Y768, Y988, Y993, Y1018)

Cell Type

Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells, Neural Stem Cells

Biology Area

Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells

Molecular Family

CD Molecules, Cytokine/Chemokine Receptors

Antigen References

1. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435.
2. Gilbertson DG, et al. 2001. J. Biol. Chem. 276:27406.
3. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771.
4. Rupp E, et al. 1994. Eur. J. Biochem. 225:29.

Gene ID

5156 View all products for this Gene ID

UniProt

View information about CD140a on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats