TotalSeq™-A0166 anti-human CD66b Antibody

Pricing & Availability
Clone
6/40c (See other available formats)
Regulatory Status
RUO
Other Names
CEACAM8, CD67, CGM6, NCA-95
Isotype
Mouse IgG1, κ
Barcode Sequence
AGCTGTAAGTTTCGG
Compare all formats
Cat # Size Price Quantity Check Availability
392905 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD66b is a 95-100 kD glycosylphosphatidylinositol (GPI)-linked protein also known as CD67, CGM6, and NCA-95. CD66b is a member of the immunoglobulin superfamily, carcinoembryonic antigen (CEA)-like subfamily. CD66b, expressed on granulocytes, has been reported to induce activation in neutrophils and to be involved in heterophilic adhesion with CD66c.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant soluble human CEACAM8-Fc produced in HEK293 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Singer, et al. 2014. PLoS One. 9(4):e94106. PMID: 24743304
  2. Klaile, et al. 2013. Respir Res. 14:85. PMID 23941132
Product Citations
  1. Witkowski MT, et al. 2020. Cancer Cell. 37:867. PubMed
  2. Swanson E, et al. 2021. eLife. 10:00. PubMed
  3. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2750372 (BioLegend Cat. No. 392905)

Antigen Details

Structure
Ig superfamily, CEA antigen group, GPI-linked glycoprotein
Distribution

Granulocytes

Function
Cell adhesion, neutrophil activation
Ligand/Receptor
CD66c
Cell Type
Granulocytes
Biology Area
Immunology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References
  1. Kuijpers T, et al. 1993. J Immunol. 151:4934.
  2. Kuroki M, et al. 1992. J Leuk Biol. 52:551.
Gene ID
1088 View all products for this Gene ID
UniProt
View information about CD66b on UniProt.org
Go To Top Version: 1    Revision Date: 08/17/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account