TotalSeq™-A0178 anti-mouse CD45.1 Antibody

Pricing & Availability
Clone
A20 (See other available formats)
Regulatory Status
RUO
Other Names
T200, Ly-5.1, LCA
Isotype
Mouse (A.SW) IgG2a, κ
Barcode Sequence
CCTATGGACTTGGAC
Cat # Size Price Quantity Check Availability
110753 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45.1 is an alloantigen of CD45, expressed by Ly5.1 bearing mouse strains (e.g., RIII, SJL/J, STS/A, DA). CD45, a member of the protein tyrosine phosphatase (PTP) family, is a 180-240 kD glycoprotein expressed on all hematopoietic cells except mature erythrocytes and platelets. There are multiple isoforms in mice that play key roles in TCR and BCR signal transduction. These isoforms are very specific to the activation and maturation states of the cell as well as specific cell types. The primary ligands for CD45 are galectin-1, CD2, CD3, CD4, TCR, CD22, and Thy-1.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
SJL mouse thymocytes and splenocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The A20 antibody does not react with leukocytes or mouse cells expressing the CD45.2 alloantigen. Additional reported applications (for relevant formats of this clone) include: immunoprecipitation3, in vitro blocking of B cell responses1,2, immunohistochemical staining of frozen sections: OCT embedded7 and acetone-fixed4-6 (direct immunofluorescence detection with fluorochrome conjugated A20 was used in (5) and (6)).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
  2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
  3. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
  4. Suzuki K, et al. 2000. Immunity 13:691. (IHC-F)
  5. Werner N, et al. 2002. Arterioscler. Thromb. Vasc. Biol. 22:1567. (IHC-F)
  6. Lessner SM, et al. 2002. Am. J. Pathol. 160:2145. (FC, IHC-F)
  7. Chen CC, et al. 2005. P. Natl. Acad. Sci. USA 102:11408 (IHC-F)
  8. Pascal V, et al. 2007. J. Immunol. 179:1751. (FC)
  9. Mende I, et al. 2006. Blood 107:1383. (IHC-F, FC)
  10. Phan TG, et al. 2007. Nature Immunol. 8:992. (FC)
  11. Wither DR, et al. 2009. J. Immunol. 183:5079. PubMed
  12. Pascal V, et al.2007. J. Immunol. 179:1751. PubMed
  13. Lee SW, et al. 2009. J. Immunol. 182:6753. PubMed
  14. Takada K, et al. 2009. J. Exp Med. 206:2253. PubMed
  15. Beamer CA, et al. 2007. Am. J. Respir. Cell. Mol. Biol. 37:729. (FC) PubMed
  16. Li LX, et al. 2010. J. Immunol. 184:1728. PubMed
  17. Hosoi A, et al. 2008. Cancer Res. 68:3941. (FC) PubMed
  18. Kenna TJ, et al. 2008. Blood 111:2091. PubMed
  19. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed
RRID
AB_2800573 (BioLegend Cat. No. 110753)

Antigen Details

Structure
Protein tyrosine phosphatase (PTP) family, 180-240 kD
Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.1 strain of mice

Function
Phosphatase, T and B cell activation
Ligand/Receptor
Galectin-1, CD2, CD3, CD4
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Trowbridge IS, et al. 1993. Annu. Rev. Immunol. 12:85.
3. Kishihara K, et al. 1993. Cell 74:143.
4. Pulido R, et al. 1988. J. Immunol. 140:3851.

Gene ID
19264 View all products for this Gene ID
UniProt
View information about CD45.1 on UniProt.org
Go To Top Version: 1    Revision Date: 01/02/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account