- Clone
- MIH6 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Programmed cell death ligand 1 (PD-L1), B7 homolog 1 (B7-H1), B7-H, B7H1, PDL1, PDCD1L1, PDCD1LG1
- Isotype
- Rat IgG2a, λ
- Barcode Sequence
- TCGATTCCACCAACT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
153604 | 10 µg | $369.00 |
CD274, also known as B7-H1 or programmed death ligand 1 (PD-L1), is a 40 kD type I transmembrane protein and a member of the B7 family within the immunoglobulin receptor superfamily. It is expressed on T cells, B cells, NK cells, dendritic cells, IFN-γ activated endothelial cells, and monocytes. B7-H1 is one of the ligands of PD-1. The interaction of B7-H1 with PD-1 plays an important role in the inhibition of T cell responses. Other studies have shown that B7-H1 is able to costimulate T cell growth and cytokine production. CD274 is involved in costimulation essential for T cell proliferation and production of IL-10 and IFN-γ, in an IL-2-dependent and a PD-1-independent manner. Its interaction with PD-1 inhibits T cell proliferation and cytokine production.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse PD-L1-transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
mAb MIH6 blocks the binding of mouse PD-L1 to PD-1 (CD279)
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Gassner FJ, et al. 2015. Br J Haematol. 170:515 (Block)
- Haile ST, et al. 2013. J Immunol. 191:2829 (FC)
- Hirahara K, et al. 2012. Immunity. 36:1017 (Block)
- Fife BT, et al. 2009. Nat Immunol. 10:1185 (Block)
- Kanai T, et al. 2003. J Immunol. 171:4156 (Block)
- Product Citations
-
- RRID
-
AB_2783125 (BioLegend Cat. No. 153604)
Antigen Details
- Structure
- Type 1 transmembrane protein, member of the B7 family, 40kD.
- Distribution
-
T cells, B cells, NK cells, dendritic cells, IFN-γ activated endothelial cells, and monocytes
- Function
- CD274 is involved in the costimulatory signal, essential for T lymphocyte proliferation and production of IL-10 and IFN-γ, in an IL-2-dependent and a PD-1-CD1-independent manner. Its interaction with PD-1-CD1 inhibits T-cell proliferation and cytokine production.
- Ligand/Receptor
- PD-1 (CD279)
- Cell Type
- B cells, Dendritic cells, Endothelial cells, Monocytes, NK cells, T cells
- Biology Area
- Cancer Biomarkers, Costimulatory Molecules, Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Dorand RD. 2016. Science. 353:399.
2. Khan AR, et al. 2015. Nat Commun. 6:5997.
3. Kiyasu J, et al. 2015. Blood. 126:2193
4. Herold M, et al. 2015. J Immunol. 195:3584
5. Buddhisa S, et al. 2015. J Immunol. 194:4413 - Gene ID
- 60533 View all products for this Gene ID
- UniProt
- View information about CD274 on UniProt.org
Other Formats
View All CD274 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Ultra-LEAF™ Purified anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | FC,Block |
TotalSeq™-A0190 anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | PG |
Brilliant Violet 605™ anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | FC |
TotalSeq™-B0190 anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | PG |
TotalSeq™-C0190 anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | PG |
PE anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | FC |
PE/Cyanine7 anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | FC |
APC anti-mouse CD274 (B7-H1, PD-L1) | MIH6 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Ultra-LEAF™ Purified anti-mouse CD274 (B7-H1, PD-L1)
-
TotalSeq™-A0190 anti-mouse CD274 (B7-H1, PD-L1)
-
Brilliant Violet 605™ anti-mouse CD274 (B7-H1, PD-L1)
-
TotalSeq™-B0190 anti-mouse CD274 (B7-H1, PD-L1)
-
TotalSeq™-C0190 anti-mouse CD274 (B7-H1, PD-L1)
-
PE anti-mouse CD274 (B7-H1, PD-L1)
-
PE/Cyanine7 anti-mouse CD274 (B7-H1, PD-L1)
-
APC anti-mouse CD274 (B7-H1, PD-L1)