TotalSeq™-A0190 anti-mouse CD274 (B7-H1, PD-L1) Antibody

Pricing & Availability
Clone
MIH6 (See other available formats)
Regulatory Status
RUO
Other Names
Programmed cell death ligand 1 (PD-L1), B7 homolog 1 (B7-H1), B7-H, B7H1, PDL1, PDCD1L1, PDCD1LG1
Isotype
Rat IgG2a, λ
Barcode Sequence
TCGATTCCACCAACT
Cat # Size Price Quantity Check Availability
153604 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD274, also known as B7-H1 or programmed death ligand 1 (PD-L1), is a 40 kD type I transmembrane protein and a member of the B7 family within the immunoglobulin receptor superfamily. It is expressed on T cells, B cells, NK cells, dendritic cells, IFN-γ activated endothelial cells, and monocytes. B7-H1 is one of the ligands of PD-1. The interaction of B7-H1 with PD-1 plays an important role in the inhibition of T cell responses. Other studies have shown that B7-H1 is able to costimulate T cell growth and cytokine production. CD274 is involved in costimulation essential for T cell proliferation and production of IL-10 and IFN-γ, in an IL-2-dependent and a PD-1-independent manner. Its interaction with PD-1 inhibits T cell proliferation and cytokine production.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse PD-L1-transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

mAb MIH6 blocks the binding of mouse PD-L1 to PD-1 (CD279)

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Gassner FJ, et al. 2015. Br J Haematol. 170:515 (Block)
  2. Haile ST, et al. 2013. J Immunol. 191:2829 (FC)
  3. Hirahara K, et al. 2012. Immunity. 36:1017 (Block)
  4. Fife BT, et al. 2009. Nat Immunol. 10:1185 (Block)
  5. Kanai T, et al. 2003. J Immunol. 171:4156 (Block)
Product Citations
  1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed
  2. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  3. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  4. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2783125 (BioLegend Cat. No. 153604)

Antigen Details

Structure
Type 1 transmembrane protein, member of the B7 family, 40kD.
Distribution

T cells, B cells, NK cells, dendritic cells, IFN-γ activated endothelial cells, and monocytes

Function
CD274 is involved in the costimulatory signal, essential for T lymphocyte proliferation and production of IL-10 and IFN-γ, in an IL-2-dependent and a PD-1-CD1-independent manner. Its interaction with PD-1-CD1 inhibits T-cell proliferation and cytokine production.
Ligand/Receptor
PD-1 (CD279)
Cell Type
B cells, Dendritic cells, Endothelial cells, Monocytes, NK cells, T cells
Biology Area
Cancer Biomarkers, Costimulatory Molecules, Immunology
Molecular Family
Adhesion Molecules, CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Dorand RD. 2016. Science. 353:399.
2. Khan AR, et al. 2015. Nat Commun. 6:5997.
3. Kiyasu J, et al. 2015. Blood. 126:2193
4. Herold M, et al. 2015. J Immunol. 195:3584
5. Buddhisa S, et  al. 2015. J Immunol. 194:4413

Gene ID
60533 View all products for this Gene ID
UniProt
View information about CD274 on UniProt.org
Go To Top Version: 2    Revision Date: 10/29/2020

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account