TotalSeq™-A0192 anti-mouse CD20 Antibody

Pricing & Availability
Clone
SA275A11 (See other available formats)
Regulatory Status
RUO
Other Names
Ms4a1, Ly-44
Isotype
Rat IgG2b, κ
Barcode Sequence
TCCACTCCCTGTATA
Compare all formats
Cat # Size Price Quantity Check Availability
150423 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD20 is a 33-37 kD protein, a member of the MS4A family, with four transmembrane spanning regions that present as a homo-oligomeric complexes in the cell surface when associating with MHC class I and II, CD53, CD81, and CD82. CD20 is expressed on B cells and a subset of T cells, but not on plasma cells. CD20 regulates B-cell activation and proliferation. Its ligation promotes transmembrane Ca2+ trafficking. CD20 is an important therapeutic target in the treatment of B cell lymphomas and leukemias.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse CD20 - transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

RRID
AB_2734214 (BioLegend Cat. No. 150423)

Antigen Details

Structure
Member of the MS4A family, four transmembrane spanning regions, three isoforms of 37, 35, and 37 kD, depending on the phosphorylation degree.
Distribution

B cells and a subset of T cells.

Function
Regulates B-cell activation and proliferation.
Interaction
Associated with MHC class I and II, CD53, CD81, and CD82.
Cell Type
B cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Morsy DE, et al. 2013. J. Immunol. 191:3112.
2. Lund FE, Randall TD. 2010. Nat. Rev. Immunol. 10:236.
3. Beers SA, et al. 2010. Blood 115:5191.
4. Kuijpers TW, et al. 2010. J. Clin. Invest. 120:214.

Gene ID
12482 View all products for this Gene ID
UniProt
View information about CD20 on UniProt.org
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account