TotalSeq™-A0194 anti-mouse CD137 Antibody

Pricing & Availability
Clone
17B5 (See other available formats)
Regulatory Status
RUO
Other Names
4-1BB, TNFRSF9, Ly-63, ILA (Induced by Lymphocyte Activation), CD137
Isotype
Syrian Hamster IgG
Barcode Sequence
TCCCTGTATAGATGA
Compare all formats
Cat # Size Price Quantity Check Availability
106111 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD137 is a 39 kD TNF-receptor superfamily member also known as 4-1BB, TNFRSF9, Ly-63, and ILA (Induced by Lymphocyte Activation). CD137 is expressed as monomers, dimers, and tetramers on activated T and B cells. Interaction of CD137 with its ligand, 4-1BBL (CD137L), is important in T-B cell costimulation. The 17B5 antibody has been reported to block 4-1BBL costimulated T cell proliferation.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Syrian Hamster
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: in vitro blocking of 4-1BB-mediated T cell proliferation2. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 106108).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Lee SW, et al. 2005. J. Immunol. 174:6803. (FC)
  2. Zheng G, et al. 2004. J. Immunol. 173:2428. (Block)
  3. Zheng H and G. G. Meadows 2005. J. Leukocyte Biol. 78:1070. (FC) PubMed
  4. Nishimoto H, et al. 2005. Blood 106:4241. (FC)
  5. del Rio ML, et al. 2011. Transpl. Int. 24:501. (FC) PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
RRID
AB_2783048 (BioLegend Cat. No. 106111)
Disclaimer

This product may be used for research purposes only. It is not licensed for resale and may only be used by the buyer. This product may not be used and is not licensed for clinical assays where the results of such assays are provided as a diagnostic service. If a diagnostic or therapeutic use is anticipated then a license must be requested from the University of California. The availability of such diagnostic and therapeutic use license(s) cannot be guaranteed from the University of California.

Antigen Details

Structure
TNF-R superfamily, 39 kD
Distribution

Activated T cells and B cells

Function
T-B cell costimulation
Ligand/Receptor
4-1BB ligand (CDw137L)
Cell Type
B cells, T cells, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Alderson MR, et al. 1994. Eur. J. Immunol. 24:2219.
3. Schwarz H, et al. 1996. Blood 87:2839.

Gene ID
21942 View all products for this Gene ID
UniProt
View information about CD137 on UniProt.org
Go To Top Version: 1    Revision Date: 09/05/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account