- Clone
- GIR-208 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI C-110
- Other Names
- IFN-γR, IFN-γRα, IFN-gamma R1, CDw119
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGTGTATTCCCTTGT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
308607 | 10 µg | $369.00 |
CDw119 is a 90-100 kD type I transmembrane protein, also known as IFN-γ R α chain or IFN-γRI. The IFN-γ receptor is a complex of a high affinity IFN-γ-binding chain (aka, IFN-γ R α chain) and a second accessory protein required for signal transduction known as IFN-γ R β chain. The IFN-γ R α chain is a member of the class II cytokine receptor family. Binding of IFN-γ induces receptor dimerization and internalization. Signal transduction involves Jak1 and Jak2 protein kinases and involves STAT1 activation. The IFN-γ receptor is expressed at moderate levels on virtually every cell with the exception of erythrocytes.
Product Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human IFN-γRα, Purified from human placenta
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Western blotting1 under non-reducing conditions, immunoprecipitation1, immunohistochemistry3 of snap frozen sections, and blocking1 of IFN-? binding to IFN-? R a chain. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 308606) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by SAv-PE (Cat. No. 405204)). The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 308609 & 308610).
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Sheehan K, et al. 1988. J. Immunol. 140:4231. (WB IP Block)
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
- Peyman JA, et al. 1992. J. Immunol. 149:2675. (IHC)
- Product Citations
-
- RRID
-
AB_2750385 (BioLegend Cat. No. 308607)
Antigen Details
- Structure
- Ig superfamily, class II cytokine receptor family, associates with IFN-γ receptor β subunit, 90-100 kD
- Distribution
-
Macrophages, monocytes, B, T, and NK cells, neutrophils, endothelial and epithelial cells, fibroblasts
- Function
- Activates Jak1, Jak2, STAT1, host defense
- Ligand/Receptor
- IFN-γ
- Cell Type
- B cells, Endothelial cells, Epithelial cells, Macrophages, Monocytes, Neutrophils, NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Calderon J, et al. 1988. P. Natl. Acad. Sci. USA 85:4837.
2. Basler C, et al. 2002. Int. Rev. Immunol. 21:305.
3. Brierley M, et al. 2002. J. Interferon Cytokine Res. 22:835. - Gene ID
- 3459 View all products for this Gene ID
- UniProt
- View information about CD119 on UniProt.org
Other Formats
View All CD119 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD119 (IFN-γ R α chain) | GIR-208 | FC |
TotalSeq™-A0219 anti-human CD119 (IFN-γ R α chain) | GIR-208 | PG |
Ultra-LEAF™ Purified anti-human CD119 (IFN-γ R α chain) | GIR-208 | FC |
TotalSeq™-B0219 anti-human CD119 (IFN-γ R α chain) | GIR-208 | PG |
TotalSeq™-C0219 anti-human CD119 (IFN-γ R α chain) | GIR-208 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.