TotalSeq™-A0356 anti-human CD254 (TRANCE, RANKL) Antibody

Pricing & Availability
Clone
MIH24 (See other available formats)
Regulatory Status
RUO
Other Names
TRANCE (TNF-related activation-induced cytokine receptor), CD254, RANK-L (receptor activator of NF-κB ligand), OPGL (Osteoprotegerin ligand), SOFA, TNFSF-11
Isotype
Mouse IgG2b, κ
Barcode Sequence
TCCGTGTTAGTTTGT
Compare all formats
Cat # Size Price Quantity Check Availability
347509 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Human CD254, also known as RANKL, TRANCE, and OPGL, is a type II transmembrane protein in the TNF superfamily that has two forms: a membrane-anchored protein and a secreted protein. Its extracellular domain is related to TRAIL, FasL, and TNF. CD254 is expressed on osteoblasts and activated T cells. It has been implicated in the regulation of the interactions between T cells and dendritic cells. It plays an important role in osteoblast differentiation and bone resorption. CD254 activates JNK and NF-κB and induces the expression of IL-1, IL-6, IL-12, and IL-15 in dendritic cells.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
RANKL-transfected L cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats of this clone) include: ELISA and immunohistochemical staining of paraffin-embedded tissue sections2.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kanamaru F, et al. 2004. Immunol. Lett. 94:239.
  2. Mueller A, et al. 2014. Arthritis Res. Ther. 16:R55. (IHC) PubMed
Product Citations
  1. Leader AM, et al. 2021. Cancer Cell. 39:1594. PubMed
RRID
AB_2750377 (BioLegend Cat. No. 347509)

Antigen Details

Structure
A TNF superfamily member.
Distribution

Expressed on osteoblasts and activated T cells.

Function
Plays an important role in osteoblast differentiation and bone resorption, regulates the interactions between T cells and dendritic cells, and T cells and B cells.
Ligand/Receptor
RANK, OPG.
Cell Type
T cells
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokines/Chemokines
Antigen References

1. Wiethe C, et al. 2003. J. Immunol. 171:4121
2. Page G, et al. 2005. Arthritis Rheum. 52:2307
3. Ji JD, et al. 2009. J. Immunol. 183:7223

Gene ID
8600 View all products for this Gene ID
UniProt
View information about CD254 on UniProt.org
Go To Top Version: 1    Revision Date: 09/26/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account