TotalSeq™-A0363 anti-human CD124 (IL-4Rα) Antibody

Pricing & Availability
Clone
G077F6 (See other available formats)
Regulatory Status
RUO
Other Names
IL-4 receptor α subunit
Isotype
Mouse IgG2a, κ
Barcode Sequence
CCGTCCTGATAGATG
Cat # Size Price Quantity Check Availability
355009 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD124, also known as the alpha subunit of IL-4R, is a 140 kD transmembrane glycoprotein. It associates with either the common γ-chain (CD132) to form the type I IL-4R complex, which specifically binds IL-4, or with IL-13Ra1 to form the type II IL-4R heterodimeric complex, which binds and transduces signals from either IL-4 or IL-13.  A truncated form of IL-4Rα exists in the soluble form in biological fluids. CD124 is expressed on human B and T cells as well as a variety of other hematopoietic and non-hematopoietic cells and cell lines.  In B cells, CD124 can bind with IL-4 and IL-13 to regulate IgE antibody production. In T cells, the type I IL-4R (IL-4R/gC) is mostly responsible for Th2 cell expansion by mediating IL-4-dependent activation of the transcription factors in hematopoietic cells. The type II IL-4R (IL-4R/IL-13Ra1) is the main route for non-hematopoietic cell responses to IL-4 or IL-13.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human IL-4Rα Fc chimera
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

RRID
AB_3083188 (BioLegend Cat. No. 355009)

Antigen Details

Structure
140 kD type I transmembrane glycoprotein, associates with common γ chain or IL-13 receptor alpha-1 subunit
Distribution

B cells, T cells, endothelial cells, cancer cells

Function
Regulates IgE antibody production in B cells, Th2 cell expansion, and IL-4 or IL-13 induced response in non-hematopoietic cells
Interaction
STAT6
Ligand/Receptor
IL-4, IL-13
Cell Type
B cells, Endothelial cells, T cells
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Signal Transduction, Transcription Factors
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References
  1. Kashiwada M, et al. 2001. J. Immunol. 167:6382.
  2. Gilmour J, et al. 2008. Immunology 124:437.
  3. Hage T, et al. 1999. Cell 97:271.
Gene ID
3566 View all products for this Gene ID
UniProt
View information about CD124 on UniProt.org
Go To Top Version: 1    Revision Date: 09/19/2023

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account