TotalSeq™-A0374 anti-human CD98 Antibody

Pricing & Availability
Clone
MEM-108 (See other available formats)
Regulatory Status
RUO
Other Names
4F2, FRP-1, RL-388
Isotype
Mouse IgG1, κ
Barcode Sequence
GCACCAACAGCCATT
Cat # Size Price Quantity Check Availability
315605 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD98 is a 125 kD disulfide-linked heterodimer protein also known as 4F2 and FRP-1. It is broadly expressed on activated and transformed cells (hematopoietic and non-hematopoietic), and at low levels on quiescent cells. CD98 has been characterized as a potential amino acid transporter (neutral and dibasic amino acids) that is involved in lymphocyte activation and integrin signaling. CD98 is composed of a light chain (45 kD) and a heavy chain (80 kD). Studies with knock-out mice indicate that the CD98 heavy chain is involved in integrin-dependent cell spreading and protection against anchorage deprivation-induced apoptosis. The MEM-108 antibody is useful for flow cytometry and immunoprecipitation.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Burkitt's lymphoma cell line Raji
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York.
  2. Cantor J, et al. 2011. J. Immunol. 187:851. PubMed.
Product Citations
  1. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2750369 (BioLegend Cat. No. 315605)

Antigen Details

Structure
Disulfide-linked heterodimer, 80 kD and 45 kD reduced, 125 kD unreduced
Distribution

Broadly expressed on activated and transformed cells, not hematopoietic cell-specific. Lower levels on resting cells

Function
Potential amino acid transporter (neutral and dibasic amino acids) also involved in the activation of lymphocytes and integrin signaling. May be a target antigen for NK cells
Interaction
Actin, β1 integrins (α2β1, α3β1, α5β1, α6β1; minimally with α4β1)
Modification
Glycosylated (heavy chain)
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Leukocyte Typing VI. Kishimoto T, et al. (Eds.) Garland Publishing Inc. (1997)
2. Bron C, et al. 1986. J. Immunol. 137:397.
3. Lumadue JA, et al. 1987. Proc. Natl. Acad. Sci. 84:9204.
4. Mastroberardino L, et al. 1998. Nature 395:288.

Gene ID
6520 View all products for this Gene ID
UniProt
View information about CD98 on UniProt.org
Go To Top Version: 1    Revision Date: 09/05/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account