- Clone
- 1D3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Thymic stromal lymphopoietin protein receptor, cytokine receptor-like 2, CRL2, CRLF2, IL-XR, TSLP-R
- Isotype
- Mouse IgG2a, λ
- Barcode Sequence
- CAGTCCTCTCTGTCA
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 322907 | 10 µg | $369.00 | |||
TSLP-R, also known as thymic stromal lymphopoietin protein receptor, cytokine receptor-like 2, CRL2, and IL-XR, is a type I membrane receptor that forms a functional heterodimeric complex with IL-7R to bind TSLP. The TSLP-R contains a WSXWS motif required for proper protein folding and a box1 motif important for association with the JAKs. TSLP-R has a predicted molecular weight approximately 40 kD, and two isoforms have been reported that are produced by alternative splicing. The TSLP-R is expressed preferentially in myeloid cells including dendritic cells and activated monocytes, and is weakly expressed in T cells. Expression has also been reported in heart, skeletal muscle, and kidney tissues. TSLP binding to the heterodimeric functional receptor (TSLP-R and IL-7R) activates JAK2, STAT3 and STAT5 to stimulate cell proliferation. Ligand receptor interactions haves been implicated in the development of the hematopoietic system, dendritic cell maturation, and the maintenance and polarization of human Th2 memory T cells in allergic diseases.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human TSLP-R:Fc protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 322905/322906) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-mouse IgG (Cat. No. 405303) second step, followed by SAv-PE (Cat. No. 405204)).
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Bouchlaka MN, et al. 2013. J Exp Med. 210:2223. PubMed
- Product Citations
-
- RRID
-
AB_2800845 (BioLegend Cat. No. 322907)
Antigen Details
- Structure
- Type I membrane receptor, forms functional heterodimeric complex with IL-7R to bind TSLP. Contains WSXWS motif required for proper protein folding and a box1 motif that is important for association with the JAKs. Predicted molecular weight approximately 4
- Distribution
-
Expressed preferentially in myeloid cells including dendritic cells and activated monocytes, weakly expressed in T cells. Also expressed in heart, skeletal muscle, and kidney
- Function
- TSLP binding to functional receptor activates JAK2, STAT3 and STAT5 to stimulate cell proliferation. Has been implicated in the development of the hematopoietic system, dendritic cell maturation, and the maintenance and polarization of human Th2 memory T
- Interaction
- Together with IL-7R binds TSLP
- Cell Type
- Dendritic cells, Monocytes, T cells, Tregs
- Biology Area
- Immunology
- Molecular Family
- Cytokine/Chemokine Receptors
- Antigen References
-
1. Reche PA,et al. 2001. J. Immunol. 167:336.
2. Tonozuka Y, et al. 2001. Cytogenet. Cell. Genet. 93:23.
3. Zhang W, et al. 2001. Biochem. Biophys. Res. Commun. 281:878.
4. Wang YH, et al. 2006. Immunity 24:827. - Gene ID
- 64109 View all products for this Gene ID
- UniProt
- View information about TSLPR on UniProt.org
Other Formats
View All TSLPR Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| PE anti-human TSLPR (TSLP-R) | 1D3 | FC |
| TotalSeq™-A0387 anti-human TSLPR (TSLP-R) | 1D3 | PG |
| TotalSeq™-C0387 anti-human TSLPR (TSLP-R) | 1D3 | PG |
| TotalSeq™-B0387 anti-human TSLPR (TSLP-R) | 1D3 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human TSLPR (TSLP-R)
Human TSLPR transfected cells stained with 1D3 PE -
TotalSeq™-A0387 anti-human TSLPR (TSLP-R)
-
TotalSeq™-C0387 anti-human TSLPR (TSLP-R)
-
TotalSeq™-B0387 anti-human TSLPR (TSLP-R)