TotalSeq™-A0422 anti-mouse CD172a (SIRPα) Antibody

Pricing & Availability
Clone
P84 (See other available formats)
Regulatory Status
RUO
Other Names
SHPS-1, BIT, P84, PTPNS1, CD172 antigen-like family member A
Isotype
Rat IgG1, κ
Barcode Sequence
GATTCCCTTGTAGCA
Cat # Size Price Quantity Check Availability
144033 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD172a, also known as SIRPα, is a type I transmembrane protein with one V-set Ig-like and two C-set Ig-like domains in the extracellular portion, and two ITIM motifs and a proline-rich region in the cytoplasmic tail. CD172a is expressed by monocytes, macrophages, myeloid cells, and neuronal tissue. The phosphorylation of SIRPα ITIMs induces the recruitment and activation of the tyrosine phosphatases PTPN6 and PTPN11, resulting in the negative regulation of several biological processes. The ligands of CD172a are CD47, SP-A, and SP-D.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse brain membrane protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking SIRPa interaction with CD474, in vivo blocking of dendritic cell migration3, enhancing of macrophage phagocytosis2,4, immunohistochemical staining of cerebellum frozen sections1, immunoprecipitation2,4, and spatial biology (IBEX)5,6.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Comu S, et al. 1997. J. Neurosci. 17:8702. (IHC)
  2. Gresham HD, et al. 2000. J. Exp. Med. 191:515. (IP)
  3. Fukunaga A, et al. 2004. J. Immunol. 172:4091. (Block)
  4. Oldenborg PA, et al. 2000. Science 288:2051. (Block, IP)
  5. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  6. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Rødahl I, et al. 2021. STAR Protoc. 2:100842. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2800670 (BioLegend Cat. No. 144033)

Antigen Details

Structure
Type I transmembrane protein
Distribution

Monocytes, macrophages, myeloid cells, neuronal tissue

Function
Negative regulation of several biological processes
Interaction
PTPN6, PTPN11
Ligand/Receptor
CD47, SP-A, SP-D
Cell Type
Dendritic cells, Macrophages, Monocytes, Neutrophils
Biology Area
Cell Adhesion, Cell Biology, Immunology, Signal Transduction
Molecular Family
Adhesion Molecules, CD Molecules, Protein Kinases/Phosphatase
Antigen References

1. Zhao XW, et al. 2011. P. Natl. Acad. Sci. USA 108:18342.
2. Verjan-Garcia N, et al. 2011. J. Immunol. 187:2268.
3. Sato-Hashimoto M, et al. 2011. J. Immunol. 187:291.
4. Raymond M, et al. 2010. Eur. J. Immunol. 40:3510.

Gene ID
19261 View all products for this Gene ID
UniProt
View information about CD172alpha on UniProt.org
Go To Top Version: 1    Revision Date: 01/02/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account