TotalSeq™-A0424 anti-mouse CD14 Antibody

Pricing & Availability
Clone
Sa14-2 (See other available formats)
Regulatory Status
RUO
Other Names
LPS receptor
Isotype
Rat IgG2a, κ
Barcode Sequence
AACCAACAGTCACGT
Cat # Size Price Quantity Check Availability
123333 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD14 is a 53-55 kD glycosylphosphatidylinositol (GPI)-linked membrane glycoprotein also known as LPS receptor. CD14 is expressed on macrophages, dendritic cells, Kupffer cells, hepatocytes, and granulocytes. As a high-affinity receptor for LPS-LBP (LPS-binding protein) complex, CD14, in association with Toll-like Receptor 4 (TLR4) or 2 (TLR2), is involved in the clearance of gram-negative pathogens.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse thymus or spleen
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Product Citations
  1. Kedmi R, et al. 2022. Nature. 610:737. PubMed
  2. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2800591 (BioLegend Cat. No. 123333)

Antigen Details

Structure
GPI-linked membrane glycoprotein, 53-55 kD
Distribution

macrophages, dendritic cells, kupffer cells, hepatocytes

Function
LPS receptor, clearance of Gram-negative pathogens
Ligand/Receptor
LPS
Cell Type
Dendritic cells, Macrophages
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Stocks S, et al. 1990. Biochem. J. 268:275.
2. Akashi S, et al. 2003. J. Exp. Med. 198:1035.
3. Matsuura K, et al. 1994. J. Exp. Med. 179:1671.
4. Liu S, et al. 1998. Infect. Immun. 66:5089.

Gene ID
12475 View all products for this Gene ID
UniProt
View information about CD14 on UniProt.org
Go To Top Version: 1    Revision Date: 01/16/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account