TotalSeq™-A0431 anti-mouse CD170 (Siglec-F) Antibody

Pricing & Availability
Clone
S17007L (See other available formats)
Regulatory Status
RUO
Other Names
Siglec-5
Isotype
Rat IgG2a, κ
Barcode Sequence
TCAATCTCCGTCGCT
Cat # Size Price Quantity Check Availability
155513 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD170, also known as Siglec-F, Siglec-5, is a member of the Sialic acid-binding Ig-like lectin family, type I single pass transmembrane protein, with 4 extracellular Ig-like domains and 2 ITIM motifs in the cytoplasmic domain; preferentially binds [alpha]-2,3-linked sialic acid. Siglec F is expressed in eosinophils, alveolar macrophages and intestinal microfold (M) cells and induces apoptosis of the lung eosinophis during allergic asthma.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
RRID
AB_2832540 (BioLegend Cat. No. 155513)

Antigen Details

Structure
Member of the Sialic acid-binding Ig-like lectin family, type I, single pass, transmembrane protein, 4 extracellular Ig-like domains, 2 ITIM motifs in the cytoplasmic domain
Distribution

Eosinophils, alveolar macrophages, intestinal microfold (M) cells

Function
Induces apoptosis in eosinophils
Ligand/Receptor
[alpha]-2,3-linked sialic acid
Cell Type
Eosinophils, Macrophages
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Innate Immunity
Molecular Family
CD Molecules, Siglec Molecules
Antigen References
  1. Gicheva N, et al. 2016. Biochem. Biophys. Res. Commun. 479:1.
  2. Kiwamoto T, et al. 2015. J. Allergy Clin. Immunol. 135:1329.
  3. Suzukawa M, et al. 2013. J. Immunol. 190:5939.
  4. Patnode ML, et al. 2013. J. Biol. Chem. 288:26533.
Gene ID
233186 View all products for this Gene ID
UniProt
View information about CD170 on UniProt.org
Go To Top Version: 1    Revision Date: 02/11/2020

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account