TotalSeq™-A0433 anti-human CD325 (N-Cadherin) Antibody

Pricing & Availability
Clone
8C11 (See other available formats)
Regulatory Status
RUO
Other Names
Cadherin-2, Neural cadherin
Isotype
Mouse IgG1, κ
Barcode Sequence
CCTTCCCTTTCCTCT
Cat # Size Price Quantity Check Availability
350817 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD325 (N-cadherin) is a 130 kD, single pass transmembrane protein. Its extracellular region consists of five EC domains and has one cytoplasmic domain. N-cadherin is involved in organogenesis and maintenance of organ architecture by contributing to the sorting of heterogeneous cell types and in the cell adhesion needed to form tissues. N-cadherin is expressed by stem cells, myeloblasts, endothelial cells, and fibroblasts, and also is expressed in neural and muscle tissues and some types of carcinoma cells. CD325 associates with the cytoskeleton trough catenin proteins.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human N-cadherin extracellular domain
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The mAb 8C11 recognizes the amino acids 92–593 of CD325, located between the extracellular cadherin structural domain (EC) 3 and 4. Additional reported applications (for the relevant formats) include: immunofluorescence1,3,6, motility inhibition of N-cadherin-expressing cells2, and Western blot2,4.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Navarro P, et al. 1998. J. Cell Biol. 140:1475. (IF)
  2. Kim JB. 2000. J. Cell Biol. 151:1193. (Block, WB)
  3. Puch S, et al. 2001. J. Cell. Sci. 114:1567. (IF)
  4. Wahl JK. 3rd, et al. 2003. J. Biol. Chem. 278:17269. (WB)
  5. Wein F, et al. 2010. Stem. Cell Res. 4:129. (FC)
  6. Jaggi M, et al. 2002. Cell. Commun. Adhes. 9:103. (IF)
Product Citations
  1. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2810555 (BioLegend Cat. No. 350817)

Antigen Details

Structure
Member of cadherin family, Single pass transmembrane protein, extracellular region consist of five EC domains, one cytoplasmic domain, 130 kD
Distribution

Stem cells, myeloblasts, endothelial cells, fibroblasts, neural and muscle tissues, some types of carcinoma cells

Function
Embryonic development, maintain tissue architecture, cell sorting and cell adhesion in tissues, promote motility
Interaction
Catenins
Cell Type
Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors, Mesenchymal Stem Cells, Neural Stem Cells
Biology Area
Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells, Synaptic Biology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Colomiere M, et al. 2009. Brit. J. Cancer 100:134.
2. Yan W, et al. 2010. J. Biol. Chem. 285:14042.
3. Mosnier JF, et al. 2009. Mod. Pathol. 22:182.
4. Gao L, et al. 2010. Stem Cells 28:564.

Gene ID
1000 View all products for this Gene ID
UniProt
View information about CD325 on UniProt.org
Go To Top Version: 1    Revision Date: 05/17/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account