- Clone
- 4C7 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CLEC4K
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CGATTTGTATTCCCT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
144217 | 10 µg | $369.00 |
CD207, also known as langerin, is a 40 kD single-pass type II transmembrane protein, member of the C-type lectin family. CD207 is expressed on the cell surface and Birbeck granules (BGs) of Langerhans cells, and subsets of thymic and splenic dendritic cells. Its ligands are mannose, n-acetylglucosamine, fucose, and sulfated glycans. Langerin is involved in the antigen processing pathway through capture and internalization of its ligands.
Product Details
- Verified Reactivity
- Mouse, Human
- Reported Reactivity
- Cynomolgus, Rabbit, Pig
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Langerin extracellular domain-Fc fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. - RRID
-
AB_3106232 (BioLegend Cat. No. 144217)
Antigen Details
- Structure
- Single-pass type II transmembrane protein, 40 kD, one C-type lectin domain, homotrimer
- Distribution
-
Langerhans cells, subsets of thymic and splenic dendritic cells
- Function
- Antigen uptake, antigen processing
- Ligand/Receptor
- Mannose, n-acetylglucosamine, fucose, sulfated glycans
- Cell Type
- Dendritic cells, Langerhans cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
1. Romani N, et al. 2012. Curr. Top. Microbiol. Immunol. 351:113.
2. Kaplan DH. 2010. Trends Immunol. 31:446.
3. Clausen BE and Kel JM. 2010. Immunol. Cell. Biol. 88:351.
4. Merad M, et al. 2008. Nat. Rev. Immunol. 8:935. - Gene ID
- 246278 View all products for this Gene ID 50489 View all products for this Gene ID
- UniProt
- View information about CD207 on UniProt.org
Other Formats
View All CD207 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-mouse/human CD207 (Langerin) | 4C7 | FC |
PE anti-mouse/human CD207 (Langerin) | 4C7 | FC,IHC |
APC anti-mouse/human CD207 (Langerin) | 4C7 | FC |
TotalSeq™-C0437 anti-mouse/human CD207 (Langerin) | 4C7 | PG |
PE/Cyanine7 anti-mouse/human CD207 (Langerin) | 4C7 | FC |
PE/Dazzle™ 594 anti-mouse/human CD207 (Langerin) | 4C7 | FC |
TotalSeq™-B0437 anti-mouse/human CD207 (Langerin) | 4C7 | PG |
PerCP/Cyanine5.5 anti-mouse/human CD207 (Langerin) | 4C7 | FC |
TotalSeq™-A0437 anti-mouse/human CD207 (Langerin) | 4C7 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse/human CD207 (Langerin)
-
PE anti-mouse/human CD207 (Langerin)
-
APC anti-mouse/human CD207 (Langerin)
-
TotalSeq™-C0437 anti-mouse/human CD207 (Langerin)
-
PE/Cyanine7 anti-mouse/human CD207 (Langerin)
-
PE/Dazzle™ 594 anti-mouse/human CD207 (Langerin)
-
TotalSeq™-B0437 anti-mouse/human CD207 (Langerin)
-
PerCP/Cyanine5.5 anti-mouse/human CD207 (Langerin)
-
TotalSeq™-A0437 anti-mouse/human CD207 (Langerin)