TotalSeq™-A0573 anti-mouse CD140a Antibody

Pricing & Availability
Clone
APA5 (See other available formats)
Regulatory Status
RUO
Other Names
PDGF receptor-α, PDGFR-α
Isotype
Rat IgG2a, κ
Barcode Sequence
GTCATTGCGGTCCTA
Cat # Size Price Quantity Check Availability
135917 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Platelet-derived growth factor receptor-α (PDGFR-α), CD140a, is one of two receptors for platelet-derived growth factors (PDGFs) and binds to all isoforms of PDGFs: PDGF-AA, PDGF-AB, and PDGF-BB. PDGFRa is a receptor tyrosine kinase that forms homodimers or heterodimers on the surface upon ligand binding and phosphorylates substrates. PDGFRs consist of either homodimers of α/α, β/β, or heterodimers of α/β. PDGF receptors, α and β, are single glycoproteins with intracellular tyrosine kinase domain. Their ligand, PDGF, is a mitogen for connective tissue and glial cells. CD140a is expressed on embryonic tissues and mesenchymal-derived cells of adult mice. PDGF plays a role in wound healing and acts as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes, and neutrophils.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse PDGFR-α-hIgG1 recombinant fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for relevant formats) applications include: Western Blot, blocking function2, and immunohistochemical staining of paraffin and frozen sections. The LEAF™ purified antibody is recommended for functional assays.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Takakura N, et al. 1996. J. Invest. Dermatol. 107:770.
  2. Liao C, et al. 2010. J. Clin. Invest. 120:242. (Block)
  3. Chen H, et al. 2015. ASN Neuro 8:7. PubMed.
  4. Miyawaki T, et al. 2004. J Neurosci. 24(37): 8124-34. (IHC-F)
RRID
AB_2783094 (BioLegend Cat. No. 135917)

Antigen Details

Structure
Alpha chain of the platelet-derived growth factor receptor, a receptor tyrosine kinase that forms homo- or hetero-dimers on the surface after ligand binding.
Distribution

Expressed on embryonic tissues and mesenchymal-derived cells of adult mouse.

Function
Play a role in wound healing and act as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes and neutrophils.
Ligand/Receptor
PDGFs
Cell Type
Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Mukouyama YS, et al. 2006. Proc Natl Acad Sci USA. 103(5):1551
2. Miyawaki T, et al. 2004. J Neurosci. 24(37):8124
3. Takakura N, et al. 1997. J Histochem Cytochem. 45(6):883

Gene ID
18595 View all products for this Gene ID
UniProt
View information about CD140a on UniProt.org
Go To Top Version: 1    Revision Date: 11/28/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account