- Clone
- APA5 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- PDGF receptor-α, PDGFR-α
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- GTCATTGCGGTCCTA
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
135917 | 10 µg | $369.00 |
Platelet-derived growth factor receptor-α (PDGFR-α), CD140a, is one of two receptors for platelet-derived growth factors (PDGFs) and binds to all isoforms of PDGFs: PDGF-AA, PDGF-AB, and PDGF-BB. PDGFRa is a receptor tyrosine kinase that forms homodimers or heterodimers on the surface upon ligand binding and phosphorylates substrates. PDGFRs consist of either homodimers of α/α, β/β, or heterodimers of α/β. PDGF receptors, α and β, are single glycoproteins with intracellular tyrosine kinase domain. Their ligand, PDGF, is a mitogen for connective tissue and glial cells. CD140a is expressed on embryonic tissues and mesenchymal-derived cells of adult mice. PDGF plays a role in wound healing and acts as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes, and neutrophils.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse PDGFR-α-hIgG1 recombinant fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported (for relevant formats) applications include: Western Blot, blocking function2, and immunohistochemical staining of paraffin and frozen sections. The LEAF™ purified antibody is recommended for functional assays.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Takakura N, et al. 1996. J. Invest. Dermatol. 107:770.
- Liao C, et al. 2010. J. Clin. Invest. 120:242. (Block)
- Chen H, et al. 2015. ASN Neuro 8:7. PubMed.
- Miyawaki T, et al. 2004. J Neurosci. 24(37): 8124-34. (IHC-F)
- RRID
-
AB_2783094 (BioLegend Cat. No. 135917)
Antigen Details
- Structure
- Alpha chain of the platelet-derived growth factor receptor, a receptor tyrosine kinase that forms homo- or hetero-dimers on the surface after ligand binding.
- Distribution
-
Expressed on embryonic tissues and mesenchymal-derived cells of adult mouse.
- Function
- Play a role in wound healing and act as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes and neutrophils.
- Ligand/Receptor
- PDGFs
- Cell Type
- Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells
- Biology Area
- Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Mukouyama YS, et al. 2006. Proc Natl Acad Sci USA. 103(5):1551
2. Miyawaki T, et al. 2004. J Neurosci. 24(37):8124
3. Takakura N, et al. 1997. J Histochem Cytochem. 45(6):883 - Gene ID
- 18595 View all products for this Gene ID
- UniProt
- View information about CD140a on UniProt.org
Other Formats
View All CD140a Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-mouse CD140a | APA5 | FC,WB,IHC-P,IHC-F |
PE anti-mouse CD140a | APA5 | FC |
APC anti-mouse CD140a | APA5 | FC |
Biotin anti-mouse CD140a | APA5 | FC |
PerCP/Cyanine5.5 anti-mouse CD140a | APA5 | FC |
PE/Cyanine7 anti-mouse CD140a | APA5 | FC |
Brilliant Violet 605™ anti-mouse CD140a | APA5 | FC |
TotalSeq™-A0573 anti-mouse CD140a | APA5 | PG |
Brilliant Violet 421™ anti-mouse CD140a | APA5 | FC |
PE/Cyanine5 anti-mouse CD140a | APA5 | FC |
PE/Dazzle™ 594 anti-mouse CD140a | APA5 | FC |
TotalSeq™-C0573 anti-mouse CD140a | APA5 | PG |
TotalSeq™-B0573 anti-mouse CD140a | APA5 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse CD140a
-
PE anti-mouse CD140a
-
APC anti-mouse CD140a
-
Biotin anti-mouse CD140a
-
PerCP/Cyanine5.5 anti-mouse CD140a
-
PE/Cyanine7 anti-mouse CD140a
-
Brilliant Violet 605™ anti-mouse CD140a
-
TotalSeq™-A0573 anti-mouse CD140a
-
Brilliant Violet 421™ anti-mouse CD140a
-
PE/Cyanine5 anti-mouse CD140a
-
PE/Dazzle™ 594 anti-mouse CD140a
-
TotalSeq™-C0573 anti-mouse CD140a
-
TotalSeq™-B0573 anti-mouse CD140a