TotalSeq™-A0851 anti-mouse CD1d (CD1.1, Ly-38) Antibody

Pricing & Availability
Clone
1B1 (See other available formats)
Regulatory Status
RUO
Other Names
CD1, CD1.1, Ly-38
Isotype
Rat IgG2b, κ
Barcode Sequence
CAACTTGGCCGAATC
Cat # Size Price Quantity Check Availability
123529 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD1d, known as CD1.1 and Ly-38, is a 48 kD type I membrane glycoprotein with structural similarities to MHC class I and is non-covalently associated with β2-microglobulin. In humans, CD1 family consists of group I proteins (CD1a, CD1b, and CD1c), group II (CD1d), and group III (CD1e). But CD1d is the only CD1 molecule has been found in mouse. Mouse CD1d has broad tissue distribution, and is found on leukocytes, dendritic cells, epithelial cells, and thymocytes. CD1d plays a role in non-peptide glycolipid antigen presentation to CD1d-restricted T cells. It has been shown that PKCδ is a critical regulator of CD1d-mediated antigen presentation.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse Cd1.1 cDNA-transfected RMA-S mouse T lymphoma
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation, immunohistochemistical staining, and blocking function3.
 

This product is for research use only and is not to be used for commercial purposes. Use of this product to produce products for sale or for diagnostic, therapeutic or drug discovery purposes is prohibited. In order to obtain a license to use this product for commercial purposes, contact the Regents of the University of California.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Fischer K, et al. 2004. P. Natl. Acad. Sci. USA 101:10685. (Block)
  2. Brozovic S, et al. 2004. Nat. Med. 10:535.
  3. Brossay L, et al. 1997. J. Immunol.. 159:1216. (Block)
  4. Jiang J, et al. 2012. PLoS One. 7:47487. PubMed
Product Citations
  1. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  2. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2800593 (BioLegend Cat. No. 123529)

Antigen Details

Structure
48 kD glycoprotein, Ig superfamily
Distribution

leukocytes, dendritic cells, epithelial cells, thymocytes

Function
Antigen presentation
Ligand/Receptor
similar to MHC class I, associate with ß-microglobulin
Cell Type
Dendritic cells, Epithelial cells, Leukocytes, Thymocytes
Biology Area
Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Brudin N, et al. 1998. J. Immunol. 161:3271.
2. Amano M, et al. 1998. J. Immunol. 161:1710.
3. Brossay L, et al. 1997. J. Immunol. 159:1216.
4. Dougan SK, et al. 2007. Curr. Top. Microbiol. Immunol. 314:113.
5. Brutkiewicz RR, et al. 2007. Eur. J. Immunol. 37:2390.

Gene ID
12479 View all products for this Gene ID
UniProt
View information about CD1d on UniProt.org
Go To Top Version: 1    Revision Date: 03/28/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account