TotalSeq™-A0862 anti-human CD218a (IL-18Rα) Antibody

Pricing & Availability
Clone
H44 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
IL-18 receptor alpha chain, IL-18 receptor 1, IL-18 receptor related protein, CDw218a
Isotype
Mouse IgG1, κ
Barcode Sequence
TTGTTGTATCCGATC
Compare all formats
Cat # Size Price Quantity Check Availability
313815 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

IL-18 receptor is composed of an α and a β subunit that combine to form a high affinity receptor for IL-18. IL-18 receptor α chain, also known as CDw218a, is a 75-80 kD type I transmembrane protein. It is expressed on NK cells, neutrophils, endothelial cells, and subsets of T and B cells. The expression of CDw218a on lymphocytes is upregulated after activation. The interaction of IL-18 and IL-18 receptor has been reported to be implicated in promotion of Th1 cytokine production and atherogenesis.

Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human NK cell line NK0 constitutively expressing IL-18 receptors
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

 The H44 antibody is specific for IL-18 receptor a chain. Additional reported applications (for the relevant formats) include: immunohistochemistry of acetone-fixed frozen sections and neutralization1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kitasato Y, et al. 2004. Am. J. Respir. Cell Mol. Biol. 31:619. (IHC)
  2. Vermot-Desroches C, et al. 2005. Cell Immunol. 236:101. (FC)
Product Citations
  1. Guilliams M, et al. 2022. Cell. 185:379. PubMed
RRID
AB_2810476 (BioLegend Cat. No. 313815)

Antigen Details

Structure
Type I membrane protein, IL-1 receptor family, approximately 75-80 kD
Distribution

Expressed on NK cells and neutrophils, IL-12 activated T and B cells, endothelial cells, and smooth muscle cells; highly expressed on Hodgkin's disease cell lines

Function
Binds IL-18 with low affinity; high affinity binding site formed with IL-18Rβ
Ligand/Receptor
IL-18
Cell Type
B cells, Endothelial cells, Neutrophils, NK cells, T cells
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Torigoe K, et al. 1997. J. Biol. Chem. 272:25737.
2. Gerdes N, et al. 2002. J. Exp. Med. 195:245.
3. Airoldi I, et al. 2000. J. Immunol. 165:6880.

Gene ID
8809 View all products for this Gene ID
UniProt
View information about CD218a on UniProt.org
Go To Top Version: 1    Revision Date: 06/12/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account