TotalSeq™-A0885 anti-mouse CD270 (HVEM) Antibody

Product Details

Verified Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Armenian Hamster

Immunogen

Mouse HVEM-hIgG1Fc fusion protein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Product Citations

1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed
2. Guilliams M, et al. 2022. Cell. 185:379. PubMed

RRID

AB_2810403 (BioLegend Cat. No. 136307)

Antigen Details

Structure

A type I transmembrane protein of TNF-receptor superfamily.

Distribution

It is expressed on most cell types, including T cells, B cells, monocytes, neutrophils, and dendritic cells. It is also found in brain, heart, kidney, liver, and other organs.

Function

Play an important role in regulating lymphocyte activation and homeostasis in immune responses.

Ligand/Receptor

LIGHT, BTLA, LTα, CD160

Cell Type

B cells, Dendritic cells, Neutrophils

Biology Area

Cell Adhesion, Cell Biology, Immunology, Signal Transduction

Molecular Family

Adhesion Molecules, CD Molecules

Antigen References

1. Fan Z, et al. 2006. Blood 107(4):1342
2. Granger SW, et al. 2008. Stem Cells. 27:653
3. Kwon BS, et al. 1997. J. Biol. Chem. 272:13471
4. Gonzalez LC, et al. 2005. Proc. Nat. Acad. Sci. U. S. A. 102:1116
5. Montgomery RI, et al. 1996. Cell. 87:427
6. Cheung TC, et al. 2009. Proc. Nat. Acad. Sci. U. S. A. 106 (15):6244
7. Cai G, et al. 2009. Immunol. Rev. 229(1):244

Gene ID

230979 View all products for this Gene ID

UniProt

View information about CD270 on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats