TotalSeq™-A0888 anti-mouse Notch 4 Antibody

Product Details

Verified Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Armenian Hamster

Immunogen

Notch4-Fc recombinant protein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Moriyama Y, et al.2008. Intl J. Immunol. 20:763.
2. Reilla LV, et al. 2011. J. Immunol. 187:4629. PubMed.

RRID

AB_2832464 (BioLegend Cat. No. 128415)

Antigen Details

Structure

Type 1 transmembrane receptor with a large extracellular domain consisting of 29 -36 EGF( epidermal growth factor) and three LNR (Lin12-Notch) repeats.

Distribution

Notch 4 is preferentially expressed in endothelial cells.

Function

Regulation of cell development, including myogenesis, neurogenesis, and lymphocyte development. Notch 4 seems to play a crucial role in vasculogenesis and angiogenesis.

Ligand/Receptor

Jagged 1, Jagged2, Delta-like 1, Delta-like3 and Delta-like 4

Cell Type

Endothelial cells

Biology Area

Immunology

Antigen References

1.Ehebauer MT,et al. 2006. Biochem J.392:13.
2.Shimizu K,et al. 2000.Mol Cell Biology. 20:18
3. Tanigaki K,et al.2007. Nature immunol. 8:451.

Gene ID

18132 View all products for this Gene ID

UniProt

View information about Notch 4 on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats