TotalSeq™-A0922 anti-human CD4 Antibody

Pricing & Availability
Clone
OKT4 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
T4
Isotype
Mouse IgG2b, κ
Barcode Sequence
GCGATCCCTTGAGAT
Cat # Size Price Quantity Check Availability
317451 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD4, also known as T4, is a 55 kD single-chain type I transmembrane glycoprotein expressed on most thymocytes, a subset of T cells, and monocytes/macrophages. CD4, a member of the Ig superfamily, recognizes antigens associated with MHC class II molecules and participates in cell-cell interactions, thymic differentiation, and signal transduction. CD4 acts as a primary receptor for HIV, binding to HIV gp120. CD4 has also been shown to interact with IL-16. 

Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human peripheral T cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The OKT4 antibody binds to the D3 domain of CD4 and does not block HIV binding. Additional reported applications (for the relevant formats) include: immunohistochemistry of frozen sections and blocking of T cell activation. This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 317453 and 317454).

In a small subset of individuals, the OKT4 clone does not bind to CD4 due to polymorphisms in CD4.9

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. Reinherz EL, et al. 1979. Proc. Natl. Acad. Sci. 76:4061.
  3. Kmieciak M, et al. 2009. J. Transl. Med. 7:89. (FC) PubMed
  4. Cicin-Sain L, et al. 2010. J. Immunol. 184:6739. PubMed
  5. Rosenzweig M, et al. 2001. J. Med. Primatol. 30:36.
  6. Linder J, et al. 1987. Am. J. Pathol. 127:1.
  7. Boche D, et al. 1999. J. Neurovirol. 5:232. (IHC)
  8. Reinherz EL, et al. 1979. Proc. Natl. Acad. Sci. USA. 76:4061. (Immunogen)
  9. Lederman S, et al. 1991. Mol Immunol. 28:1171-81.
RRID
AB_2814173 (BioLegend Cat. No. 317451)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 55 kD
Distribution

T cell subset, majority of thymocytes, monocytes/macrophages

Function
MHC class II co-receptor, lymphocyte adhesion, thymic differentiation, HIV receptor
Ligand/Receptor
MHC class II molecules, HIV gp120, IL-16
Cell Type
Macrophages, Monocytes, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Center D, et al. 1996. Immunol. Today 17:476.
2. Gaubin M, et al. 1996. Eur. J. Clin. Chem. Clin. Biochem. 34:723.

Gene ID
920 View all products for this Gene ID
UniProt
View information about CD4 on UniProt.org
Go To Top Version: 1    Revision Date: 09/11/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account