TotalSeq™-A0924 anti-mouse CD252 (OX40 Ligand) Antibody

Pricing & Availability
Clone
RM134L (See other available formats)
Regulatory Status
RUO
Other Names
OX-40L, CD134L, CD252, TNFSF4
Isotype
Rat IgG2b, κ
Barcode Sequence
TCTCAGAACAGCCCT
Cat # Size Price Quantity Check Availability
108827 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD252 is a 35 kD member of the TNF superfamily and is also known as OX40 ligand, OX40L, and CD134L. The CD252 is expressed on activated B cells and antigen presenting cells. CD252 interacts with OX40 antigen (CD134), expressed predominantly on activated T cells to increase proliferation and IL-2 production and to enhance proliferation and immunoglobulin secretion in activated B cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Rat NRK-52E cell line transfected with mouse OX-40L
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The RM134L antibody can block the costimulatory activity of OX40L. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections3, and in vivo and in vitro blocking of OX-40L-OX-40 functional interaction1,2,4. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 108808).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Akiba H, et al. 1999. J. Immunol. 162:7058. (Block)
  2. Akiba H, et al. 2000. J. Exp. Med. 191:375. (Block)
  3. Hoshino A, et al. 2003. Eur. J. Immunol. 33:861. (IHC)
  4. Terrazas LI, et al. 2005. Intl. J. Parasitology. 35:1349. (Block)
  5. Zheng X, et al. 2010. Invest Ophthalmol Vis Sci. 51:3076. PubMed
RRID
AB_2904285 (BioLegend Cat. No. 108827)

Antigen Details

Structure
NGF/TNF superfamily, 35 kD
Distribution

Activated B cells, antigen presenting cells

Function
B-cell/T-cell interaction, costimulation
Ligand/Receptor
OX40 (CD134)
Cell Type
Antigen-presenting cells, B cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Akiba H, et al. 1999. J. Immunol. 162:7058.
2. Stüber E, et al. 1995. Immunity 2:507.
3. Baum PR, et al. 1994. EMBO J. 13:3992.

Gene ID
22164 View all products for this Gene ID
UniProt
View information about CD252 on UniProt.org
Go To Top Version: 1    Revision Date: 11/11/2021

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account