- Clone
- RM134L (See other available formats)
- Regulatory Status
- RUO
- Other Names
- OX-40L, CD134L, CD252, TNFSF4
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- TCTCAGAACAGCCCT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
108827 | 10 µg | $369.00 |
CD252 is a 35 kD member of the TNF superfamily and is also known as OX40 ligand, OX40L, and CD134L. The CD252 is expressed on activated B cells and antigen presenting cells. CD252 interacts with OX40 antigen (CD134), expressed predominantly on activated T cells to increase proliferation and IL-2 production and to enhance proliferation and immunoglobulin secretion in activated B cells.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Rat NRK-52E cell line transfected with mouse OX-40L
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The RM134L antibody can block the costimulatory activity of OX40L. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections3, and in vivo and in vitro blocking of OX-40L-OX-40 functional interaction1,2,4. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 108808).
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Akiba H, et al. 1999. J. Immunol. 162:7058. (Block)
- Akiba H, et al. 2000. J. Exp. Med. 191:375. (Block)
- Hoshino A, et al. 2003. Eur. J. Immunol. 33:861. (IHC)
- Terrazas LI, et al. 2005. Intl. J. Parasitology. 35:1349. (Block)
- Zheng X, et al. 2010. Invest Ophthalmol Vis Sci. 51:3076. PubMed
- RRID
-
AB_2904285 (BioLegend Cat. No. 108827)
Antigen Details
- Structure
- NGF/TNF superfamily, 35 kD
- Distribution
-
Activated B cells, antigen presenting cells
- Function
- B-cell/T-cell interaction, costimulation
- Ligand/Receptor
- OX40 (CD134)
- Cell Type
- Antigen-presenting cells, B cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Akiba H, et al. 1999. J. Immunol. 162:7058.
2. Stüber E, et al. 1995. Immunity 2:507.
3. Baum PR, et al. 1994. EMBO J. 13:3992. - Gene ID
- 22164 View all products for this Gene ID
- UniProt
- View information about CD252 on UniProt.org
Other Formats
View All CD252 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Biotin anti-mouse CD252 (OX40L) | RM134L | FC |
PE anti-mouse CD252 (OX40L) | RM134L | FC |
Purified anti-mouse CD252 (OX40L) | RM134L | FC,IHC-F,Block |
Alexa Fluor® 647 anti-mouse CD252 (OX40L) | RM134L | FC |
APC anti-mouse CD252 (OX40L) | RM134L | FC |
PE/Cyanine7 anti-mouse CD252 (OX40L) | RM134L | FC |
PE/Dazzle™ 594 anti-mouse CD252 (OX40 Ligand) | RM134L | FC |
TotalSeq™-C0924 anti-mouse CD252 (OX40 Ligand) | RM134L | PG |
Ultra-LEAF™ Purified anti-mouse CD252 (OX40 Ligand) | RM134L | FC,IHC-F |
TotalSeq™-B0924 anti-mouse CD252 (OX40 Ligand) Antibody | RM134L | PG |
TotalSeq™-A0924 anti-mouse CD252 (OX40 Ligand) | RM134L | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Biotin anti-mouse CD252 (OX40L)
-
PE anti-mouse CD252 (OX40L)
-
Purified anti-mouse CD252 (OX40L)
-
Alexa Fluor® 647 anti-mouse CD252 (OX40L)
-
APC anti-mouse CD252 (OX40L)
-
PE/Cyanine7 anti-mouse CD252 (OX40L)
-
PE/Dazzle™ 594 anti-mouse CD252 (OX40 Ligand)
-
TotalSeq™-C0924 anti-mouse CD252 (OX40 Ligand)
-
Ultra-LEAF™ Purified anti-mouse CD252 (OX40 Ligand)
-
TotalSeq™-B0924 anti-mouse CD252 (OX40 Ligand) Antibody
-
TotalSeq™-A0924 anti-mouse CD252 (OX40 Ligand)