TotalSeq™-A0927 anti-mouse CD159a (NKG2AB6) Antibody

Pricing & Availability
Clone
16A11 (See other available formats)
Regulatory Status
RUO
Other Names
KLRC1, NKG2B, NKG2AB6
Isotype
Mouse IgG2b, κ
Barcode Sequence
GTGTTTGTGTTCCTG
Cat # Size Price Quantity Check Availability
142811 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD159a, also known as NKG2A or KLRC1 (killer cell lectin-like receptor subfamily C, member 1), is a 43 kD type II transmembrane protein with extracellular C-type lectin domains.  It belongs to the killer cell lectin-like receptor family also known as the NKG2 family.  It is expressed on NK and NKT cells and activated CD8+ T cells.  NKG2A binds to non-classical MHC class I molecule Qa-1 and causes inhibition of NK cell-mediated target-cell lysis. 

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
C57BL/6 mouse CD94/NKG2A transfected CHO cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

This product may be used for research purposes only. It is not licensed for resale and may only be used by the buyer. This product may not be used and is not licensed for clinical assays, where the results of such assays are provided as a diagnostic service. If a diagnostic or therapeutic use is anticipated, then a license must be requested from the University of California. The availability of such diagnostic and therapeutic use licenses cannot be guaranteed from the University of California.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. McMahon CW, et al. 2002. J. Immunol. 169:1444. (FC)
  2. Vance RE, et al. 2002. P. Natl. Acad. Sci. USA 99:868. (FC)
RRID
AB_2892296 (BioLegend Cat. No. 142811)

Antigen Details

Structure
Type II transmembrane protein with extracelluar C-type lectin domains, complexed with CD94; 43 kD
Distribution

NK cells and NK T cells from C57BL/6 mouse

Function
Inhibitory activity via ITIMs
Ligand/Receptor
Non-classical MHC-I molecule Qa-1
Cell Type
Embryonic Stem Cells, Mesenchymal Stem Cells, NK cells, NKT cells
Biology Area
Cell Biology, Immunology, Signal Transduction, Stem Cells
Molecular Family
CD Molecules, MHC Antigens
Antigen References

1. Vance RE, et al. 1998. J Exp Med. 188:1841-8.
2. Lohwasser S, et al. 1999. Eur J Immunol. 29:755-61.
3. Sivakumar PV, et al. 1999. J Immunol. 162:6976-80.
4. Silver ET, et al. 1999. Immunogenetics 49:727-30.
5. Vance RE, et al. 1999. J Exp Med. 190:1801-12.

Gene ID
16641 View all products for this Gene ID
UniProt
View information about CD159a on UniProt.org
Go To Top Version: 1    Revision Date: 04/06/2021

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account