TotalSeq™-A0951 PE Streptavidin

Pricing & Availability
Regulatory Status
RUO
Other Names
SAV
Barcode Sequence
AACCTTTGCCACTGC
Cat # Size Price Quantity Check Availability
405251 10 µg $397.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Technical data sheet

Product Details

Verified Reactivity
Human, Mouse, Rat, All Species
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
Streptavidin is conjugated with the fluorophore and the TotalSeq™ oligomer under optimal conditions.
Concentration
0.5 mg/mL (concentration relates to the Streptavidin only component of the conjugate)
Storage & Handling
The solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.
Application

PG - Quality tested

Recommended Usage

This streptavidin product is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. The concentration provided is based upon molecular mass of streptavidin independent of any additional molecular mass that might be added by the fluorophore or oligomer conjugation. For cell staining, the suggested use of this reagent is ≤0.06 µg per million cells in 100 µl volume. For applications related to barcoded MHC tetramers, please follow our Flex-T™ protocol. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the streptavidin dilution (0.06 µg of streptavidin in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Go To Top Version: 2    Revision Date: 01/20/2021

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

Login/Register
Forgot your password? Reset Password
Request an Account