TotalSeq™-A1011 anti-mouse CD155 (PVR) Antibody

Pricing & Availability
Clone
TX56 (See other available formats)
Regulatory Status
RUO
Other Names
PVR (poliovirus receptor) homolog
Isotype
Rat IgG2a, κ
Barcode Sequence
TAGCTTGGGATTAAG
Compare all formats
Cat # Size Price Quantity Check Availability
131531 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Mouse CD155, also known as homolog of polivirus receptor (PVR), is the founding member of a subfamily of immunoglobulin-like adhesion receptors (nectins). Mouse CD155 is expressed on a wide variety of cells of hematopoietic origin apart from its existence on the epithelial cells. The engagement of CD155 with CD226 and CD96 induces cytotoxicity of NK cells and CTL.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
CD155 transfectants
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Tahara-Hanaoka S, et al. 2004. Int. Immunol. 16:533.
  2. Maier MK, et al. 2007. Eur. J. Immunol.. 37:2214.
  3. Bottino C, et al. 2003. J. Exp. Med. 198:557.
  4. Dressel R, et al. 2010. FASEB J. 9:134. PubMed
RRID
AB_2832471 (BioLegend Cat. No. 131531)

Antigen Details

Structure
70 kd immunoglobulin-like molecule with three Ig-like domains.
Distribution

CD155 is expressed at cell junctions on the primary vascular endothelial cells. Moreover, mouse CD155 is highly expressed on DP thymocytes and expression level is dropped in peripheral single positive CD4+ and CD8+ T cells. CD155 can be detected on T reg, other activated T cells and on NKT cells. Resident monocytes express moderate amount of CD155, but upregulated its expression during inflammation. Other cells, such as IEL, neutrophils and subsets of B cells were found to express CD155 to varying extents.

Function
Apart from its function of adhering junction among contacting epithelial cells, the interaction of DNAM-1 (CD226) with its ligands CD155 and CD112 (nectin 2) induces cytotoxcity of NK cells and CD8+ T cells and cytokine secretion.
Ligand/Receptor
CD226 (DNAM-1), CD96
Cell Type
B cells, Endothelial cells, Neutrophils, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
Adhesion Molecules, CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Mendelsohn C, et al. 1989. Cell 56:855.

Gene ID
52118 View all products for this Gene ID
UniProt
View information about CD155 on UniProt.org
Go To Top Version: 1    Revision Date: 01/08/2020

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account