TotalSeq™-A1059 anti-human HLA-DQ Antibody

Pricing & Availability
Clone
Tü169 (See other available formats)
Regulatory Status
RUO
Other Names
MHC class II, Major Histocompatibility complex II, human leukocyte antigen, HLA
Isotype
Mouse IgG2a, κ
Barcode Sequence
TTCACCGTAGTACGA
Cat # Size Price Quantity Check Availability
361505 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

HLA-DQ is heterodimeric cell surface glycoprotein comprised of a 27 kD α (heavy) chain and a 32 kD β (light) chain. In contrast to other MHC class II molecules, both chains of HLA-DQ are polymorphic and the α chain shows a high degree of polymorphism. It is expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In hematopoietic development, HLA-DR and DP are expressed first, followed by HLA-DQ. Variations in the HLA gene expression are crucial to graft survival.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human PBL
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Tü169 has been reported to react with HLA-DQ1 and HLA-DQ2. It also shows weak reactivity to HLA-DQ3.

Additional reported applications (for the relevant formats) include: immunofluorescence2 and in vitro blocking1. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Benagiano M, et al. 2012. Proc. Natl. Acad. Sci. USA 109:1222. (Block)
  2. Rees LE, et al. 2003. Clin. Exp. Immunol. 134:497. (IF)
  3. Nasi A, et al. 2013. J. Immunol. 191:3090. (FC)
  4. Turrini R, et al. 2011. Cancer Immunol. Immunother. 60:1639. (FC)
RRID
AB_2860945 (BioLegend Cat. No. 361505)

Antigen Details

Structure
Ig superfamily, MHC class II, heterodimeric transmembrane protein
Distribution

B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs

Function
Antigen presentation
Ligand/Receptor
CD3/TCR, CD4
Cell Type
Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Thorsby E. 1974. Transplant. Rev. 18:51.
2. Qvigstad E, et al. 1984. Hum. Immunol. 11:207.
3. Servenius B, et al. 1984. EMBO J. 3:3209.
4. Ottenhoff TH, et al. 1985. Hum. Immunol. 13:105.
5. Strassmann G, et al. 1985. Hum. Immunol. 13:125.
6. Trowsdale J, et al. 1985. Immunol. Rev. 85:5.
7. Dorman J, et al. 2000. Epidemiologic Reviews 22:218.
8. van Lith M, et al. 2010. J. Biol. Chem. 285:40800.

Gene ID
3117 View all products for this Gene ID 3119 View all products for this Gene ID
UniProt
View information about HLA-DQ on UniProt.org
Go To Top Version: 1    Revision Date: 06/16/2020

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account