- Clone
- Tü169 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- MHC class II, Major Histocompatibility complex II, human leukocyte antigen, HLA
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TTCACCGTAGTACGA
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
361505 | 10 µg | $369.00 |
HLA-DQ is heterodimeric cell surface glycoprotein comprised of a 27 kD α (heavy) chain and a 32 kD β (light) chain. In contrast to other MHC class II molecules, both chains of HLA-DQ are polymorphic and the α chain shows a high degree of polymorphism. It is expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In hematopoietic development, HLA-DR and DP are expressed first, followed by HLA-DQ. Variations in the HLA gene expression are crucial to graft survival.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human PBL
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Tü169 has been reported to react with HLA-DQ1 and HLA-DQ2. It also shows weak reactivity to HLA-DQ3.
Additional reported applications (for the relevant formats) include: immunofluorescence2 and in vitro blocking1. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (contact our custom solutions team). - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Benagiano M, et al. 2012. Proc. Natl. Acad. Sci. USA 109:1222. (Block)
- Rees LE, et al. 2003. Clin. Exp. Immunol. 134:497. (IF)
- Nasi A, et al. 2013. J. Immunol. 191:3090. (FC)
- Turrini R, et al. 2011. Cancer Immunol. Immunother. 60:1639. (FC)
- RRID
-
AB_2860945 (BioLegend Cat. No. 361505)
Antigen Details
- Structure
- Ig superfamily, MHC class II, heterodimeric transmembrane protein
- Distribution
-
B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs
- Function
- Antigen presentation
- Ligand/Receptor
- CD3/TCR, CD4
- Cell Type
- Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- MHC Antigens
- Antigen References
-
1. Thorsby E. 1974. Transplant. Rev. 18:51.
2. Qvigstad E, et al. 1984. Hum. Immunol. 11:207.
3. Servenius B, et al. 1984. EMBO J. 3:3209.
4. Ottenhoff TH, et al. 1985. Hum. Immunol. 13:105.
5. Strassmann G, et al. 1985. Hum. Immunol. 13:125.
6. Trowsdale J, et al. 1985. Immunol. Rev. 85:5.
7. Dorman J, et al. 2000. Epidemiologic Reviews 22:218.
8. van Lith M, et al. 2010. J. Biol. Chem. 285:40800. - Gene ID
- 3117 View all products for this Gene ID 3119 View all products for this Gene ID
- UniProt
- View information about HLA-DQ on UniProt.org
Other Formats
View All HLA-DQ Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human HLA-DQ | Tü169 | FC,IHC-F |
FITC anti-human HLA-DQ | Tü169 | FC |
TotalSeq™-A1059 anti-human HLA-DQ | Tü169 | PG |
TotalSeq™-B1059 anti-human HLA-DQ | Tü169 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.