TotalSeq™-A1244 anti-human LAP (TGF-β1) Antibody

Pricing & Availability
Clone
S20006A (See other available formats)
Regulatory Status
RUO
Other Names
Latency Associated Peptide (LAP), Transforming growth factor beta 1 (TGF-b1), TGFB1, DPD1, TGF-beta1
Isotype
Mouse IgG1, κ
Barcode Sequence
AACTTCACCTCCTAG
Cat # Size Price Quantity Check Availability
300011 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

TGF-β1 (transforming growth factor β1) is a multifunctional cytokine which regulates cellular proliferation and differentiation. It is ubiquitously expressed by many types of cells. Platelets express high level of TGF-β. TGF-β is synthesized as a large protein precursor and then secreted as a complex of TGF-β and LAP (latency-associated peptide), in which LAP noncovalently associates with the dimeric mature TGF-β to prevent its activity. TGF-β requires activation before it binds to its receptors and exerts functions. It has been reported that LAP-TGF-β binds to the integrins αvβ1, αvβ6, αvβ8, and α8β1 through RGD domain. TGF-β plays important roles in control proliferation and differentiation of epithelial cells, endothelial cells, fibroblasts, neurons, osteoclasts, and osteoblasts. TGF-β is believed to be important in the regulation of the development of Treg, Th17, and Th9 cells. A recent study has shown that LAP is an activated Treg surface marker.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human TGF-β1 transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone S2006A can completely block the binding of clones TW4-2F8 and TW4-6H10 on target cells.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

RRID
AB_2910372 (BioLegend Cat. No. 300011)

Antigen Details

Structure
About 400 amino acids, N-terminal signal peptide is required for secretion from a cell, a pro-region (LAP) and C-terminal region that becomes the mature TGF-β molecule following its release from the pro-region by proteolytic cleavage.
Distribution

Ubiquitously expressed by many kinds of cells

Function
Multifunctional cytokine, regulates cells proliferation, and differentiation
Ligand/Receptor
TGF-βRI, -RII, -RIII, CD105, LTBP, integrins
Cell Type
B cells, Dendritic cells, T cells, Tregs
Biology Area
Adaptive Immunity, Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Inhibitory Molecules, Neuroinflammation, Neuroscience, Signal Transduction
Molecular Family
Cytokines/Chemokines, Growth Factors
Antigen References
  1. Yi JJ, et al. 2010. Cell. 142:144.
  2. Tran DQ, et al. 2009. Blood. 113:5125.
  3. Lu M, et al. 2002. J Cell Sci. 115:4641.
  4. Khalil N. 1999. Microbes Infect. 1:1255.
Gene ID
7040 View all products for this Gene ID
UniProt
View information about LAP on UniProt.org
Go To Top Version: 1    Revision Date: 02/25/2022

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account