TotalSeq™-A1256 anti-human CD16 Antibody

Pricing & Availability
Clone
B73.1 (See other available formats)
Regulatory Status
RUO
Other Names
FcγRIII, IGFR3, FCG3, FCGR3, FCGRIII, Fc gamma receptor, Fc gamma receptor 3
Isotype
Mouse IgG1, κ
Barcode Sequence
CTTATTTACCCGTAC
Compare all formats
Cat # Size Price Quantity Check Availability
360737 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD16 is known as low affinity IgG receptor III (FcγRIII). It is expressed as two distinct forms (CD16a and CD16b). CD16a (FcγRIIIA) is a 50-65 kD polypeptide-anchored transmembrane protein. It is expressed on the surface of NK cells, activated monocytes, macrophages, a subset of T cells and placental trophoblasts in humans. CD16b (FcγRIIIB) is a 48 kD glycosylphosphatidylinositol (GPI)-anchored protein. Its extracellular domain is over 95% homologous to that of CD16a, and it is expressed specifically on neutrophils. CD16 binds aggregated IgG or IgG-antigen complex which functions in NK cell activation, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC).

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
NK cell-enriched fraction from human peripheral blood.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The epitope recognized by clone B73.1 is in the first membrane distal Ig-like domain of the CD16 molecule, which is different from that of clone 3G84.

Donor variability has been observed for clone B73.1 staining1, especially on granulocytes.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Perussia B, et al. 1983. J. Immunol. 130:2133.
  2. Lanier LL, et al. 1985. J. Exp. Med. 162:2089.
  3. Perussia B, et al. 1984. J. Immunol. 133:180.
  4. Grier JT, et al. 2012. J. Clin. Invest. 122:3769. (Epitope)
RRID
AB_2936627 (BioLegend Cat. No. 360737)

Antigen Details

Structure
Ig superfamily, transmembrane form (50-65 kD) or GPI-linked form (48 kD)
Distribution

NK cells, activated monocytes, macrophages, neutrophils and a subset of T cells

Function
Low affinity IgG Fc receptor, phagocytosis, ADCC
Ligand/Receptor
IgG Fc receptor III (FcγRIII)
Cell Type
Macrophages, Monocytes, Neutrophils, NK cells, T cells
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Schubert J, et al. 1989. In Leucocyte Typing IV (Knapp W, ed) Oxford University Press Oxford pp 711.
2. Palmer BE, et al. 2005. J. Immunol. 175:8415.
3. Schachner M and Martini R. 1995. Trends Neurosci. 18:183.
4. Wood KL, et al. 2005. Clin. Immunol. 117:294.
5. Björkström NK, et al. 2008. J. Immunol. 181:4219.

Gene ID
2214 View all products for this Gene ID 2215 View all products for this Gene ID
UniProt
View information about CD16 on UniProt.org
Go To Top Version: 1    Revision Date: 02/28/2023

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account