- Clone
- QA19A07 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- TSPAN25
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TAGCCGGTGTGTTGT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
325711 | 10 µg | $369.00 |
CD53 is a 35-42 kD type III tetraspan membrane protein. It is expressed on all leukocytes, but not on platelets or erythrocytes. CD53 is thought to be involved in signal transduction. It has been shown to interact with a number of proteins including IL-4, CD20, CD2, CD9, IL-2, VLA-4, and CD4. Cross-linking of CD53 promotes B cell activation. The CD53 antigen is highly glycosylated and treatment with endoglycosidase F reduces the apparent molecular weight of this protein by approximately 25 kD. The HI29 antibody has been shown to be useful for flow cytometry, and immunohistochemistry (frozen).
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Recombinant
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. - RRID
-
AB_2936616 (BioLegend Cat. No. 325711)
Antigen Details
- Structure
- Cell surface protein, tetraspan family, four membrane spanning hydrophobic domains, 35-42 kD.
- Distribution
-
Hematopoietic cells including neutrophils, monocytes, B cells, T cells (single positive thymocytes and peripheral T cells), and eosinophils. Not expressed on platelets, erythrocytes, and non-hematopoietic cells.
- Function
- Signal transduction, cross-linking on B cells causes activation.
- Interaction
- IL-4, CD20, CD2, CD9, IL-2, integrin α4, integrin β1, CD4
- Ligand/Receptor
- NK cell, B cells, Neutrophils, Eosinophils
- Antigen References
-
- Amiot M. 1990. J Immunol. 145:4322-5.
- Angelisova P, et al. 1990. Immunogenetics. 32:281-5.
- Olweus J, et al. 1993. J Immunol. 153:4997.
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford: Oxford University Press.
- Gene ID
- 963 View all products for this Gene ID
- UniProt
- View information about CD53 on UniProt.org
Other Formats
View All CD53 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD53 Recombinant Antibody | QA19A07 | FC |
FITC anti-human CD53 Recombinant Antibody | QA19A07 | FC |
PE/Cyanine7 anti-human CD53 Recombinant Antibody | QA19A07 | FC |
APC anti-human CD53 Recombinant Antibody | QA19A07 | FC |
PE anti-human CD53 Recombinant Antibody | QA19A07 | FC |
TotalSeq™-A1274 anti-human CD53 Recombinant Antibody | QA19A07 | PG |
TotalSeq™-B1274 anti-human CD53 Recombinant Antibody | QA19A07 | PG |
TotalSeq™-C1274 anti-human CD53 Recombinant Antibody | QA19A07 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD53 Recombinant Antibody
-
FITC anti-human CD53 Recombinant Antibody
-
PE/Cyanine7 anti-human CD53 Recombinant Antibody
-
APC anti-human CD53 Recombinant Antibody
-
PE anti-human CD53 Recombinant Antibody
-
TotalSeq™-A1274 anti-human CD53 Recombinant Antibody
-
TotalSeq™-B1274 anti-human CD53 Recombinant Antibody
-
TotalSeq™-C1274 anti-human CD53 Recombinant Antibody