TotalSeq™-A1274 anti-human CD53 Recombinant Antibody

Pricing & Availability
Clone
QA19A07 (See other available formats)
Regulatory Status
RUO
Other Names
TSPAN25
Isotype
Mouse IgG1, κ
Barcode Sequence
TAGCCGGTGTGTTGT
Cat # Size Price Quantity Check Availability
325711 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD53 is a 35-42 kD type III tetraspan membrane protein. It is expressed on all leukocytes, but not on platelets or erythrocytes. CD53 is thought to be involved in signal transduction. It has been shown to interact with a number of proteins including IL-4, CD20, CD2, CD9, IL-2, VLA-4, and CD4. Cross-linking of CD53 promotes B cell activation. The CD53 antigen is highly glycosylated and treatment with endoglycosidase F reduces the apparent molecular weight of this protein by approximately 25 kD. The HI29 antibody has been shown to be useful for flow cytometry, and immunohistochemistry (frozen).

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Recombinant
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

RRID
AB_2936616 (BioLegend Cat. No. 325711)

Antigen Details

Structure
Cell surface protein, tetraspan family, four membrane spanning hydrophobic domains, 35-42 kD.
Distribution

Hematopoietic cells including neutrophils, monocytes, B cells, T cells (single positive thymocytes and peripheral T cells), and eosinophils. Not expressed on platelets, erythrocytes, and non-hematopoietic cells.

Function
Signal transduction, cross-linking on B cells causes activation.
Interaction
IL-4, CD20, CD2, CD9, IL-2, integrin α4, integrin β1, CD4
Ligand/Receptor
NK cell, B cells, Neutrophils, Eosinophils
Antigen References
  1. Amiot M. 1990. J Immunol. 145:4322-5.
  2. Angelisova P, et al. 1990. Immunogenetics. 32:281-5.
  3. Olweus J, et al. 1993. J Immunol. 153:4997.
  4. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford: Oxford University Press.
Gene ID
963 View all products for this Gene ID
UniProt
View information about CD53 on UniProt.org
Go To Top Version: 1    Revision Date: 02/24/2023

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account