TotalSeq™-A1289 anti-human CD3 Antibody

Pricing & Availability
Clone
OKT3 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
T3, CD3ε
Isotype
Mouse IgG2a, κ
Barcode Sequence
GATGTATTCCTTCGT
Cat # Size Price Quantity Check Availability
317363 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD3ε is a 20 kD chain of the CD3/T cell receptor (TCR) complex, which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T lymphocytes, NK T cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The OKT3 monoclonal antibody reacts with an epitope on the epsilon-subunit within the human CD3 complex.

Clone OKT3 can block the binding of clones SK7 and UCHT1.4 The OKT3 antibody is able to induce T cell activation. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections and activation of T cells. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 317304). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 317326) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Knapp W. 1989. Leucocyte Typing IV. Oxford University Press New York.
  3. Barclay N, et al. 1997. The Leucocyte Antigen Facts Book. Academic Press Inc. San Diego.
  4. Li B, et al. 2005. Immunology 116:487.
  5. Jeong HY, et al. 2008. J. Leuckocyte Biol. 83:755. PubMed
  6. Alter G, et al. 2008. J. Virol. 82:9668. PubMed
  7. Manevich-Mendelson E, et al. 2009. Blood 114:2344. PubMed
  8. Pinto JP, et al. 2010. Immunology. 130:217. PubMed
  9. Biggs MJ, et al. 2011. J. R. Soc. Interface. 8:1462. PubMed
RRID
AB_3083174 (BioLegend Cat. No. 317363)

Antigen Details

Structure
Ig superfamily, the subunits CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) form the CD3/TCR complex, 20 kD
Distribution

Mature T and NK T cells, thymocyte differentiation

Function
Antigen recognition, signal transduction, T cell activation
Ligand/Receptor
Peptide antigen bound to MHC
Cell Type
NKT cells, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References
  1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
  2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
  3. Lanier L, et al. 1986. J. Immunol. 137:2501.
Gene ID
916 View all products for this Gene ID
UniProt
View information about CD3 on UniProt.org
Go To Top Version: 1    Revision Date: 09/15/2023

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account