TotalSeq™-A1456 anti-human Ganglioside GD2 Antibody

Pricing & Availability
Clone
14G2a (See other available formats)
Regulatory Status
RUO
Other Names
Disialoganglioside GD2, Ganglioside G2
Isotype
Mouse IgG2a, κ
Barcode Sequence
TACGCAACTTCATTG
Cat # Size Price Quantity Check Availability
357329 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Ganglioside GD2 is a sialic acid-containing glycosphingolipid involved in cell attachment to the extracellular matrix. Expression of GD2 in normal tissue is restricted to cells from the central nervous system, peripheral nerves, skin melanocytes, and mesenchymal stem cells. However GD2 is highly expressed by tumors of neuro-ectodermal origin such as melanomas, gliomas, neuroblastomas, and small cell lung carcinoma. GD2 has been proposed as a marker for some cancer stem cells.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Neuroblastoma cell line LAN-1
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 14G2a is an isotype switch variant from parental hybridoma 14.18 (IgG3)1. Additional reported applications (for the relevant formats) include: inducing apoptosis and enhancing cytotoxicity of chemotherapeutic drugs in the neuroblastoma cell line 2. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for use in cytotoxic and apoptotic studies (contact our custom solutions team). This clone has also been published as 14.G2a.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Mujoo K, et al. 1989. Cancer Res. 49:2857. (Cyt)
  2. Kowalczyk A, et al. 2009. Cancer Lett. 281:171. (Apop, Cyt)
  3. Battula VL, et al. 2012. J. Clin. Invest. 122:2066. (FC)
RRID
AB_3097619 (BioLegend Cat. No. 357329)

Antigen Details

Distribution

Neurons, mesenchymal stem cells, highly expressed in tumors of neuro-ectodermal origin, such as melanomas, gliomas, neuroblastomas, and small cell lung carcinoma

Function
Cell attachment to extracellular matrix
Cell Type
Mesenchymal cells, Neurons
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Adhesion, Cell Biology, Immunology, Neuroscience
Molecular Family
Adhesion Molecules
Antigen References

1. Tarek N, et al. 2012. J. Clin. Invest. 122:3260.
2. Matthay KK, et al. 2012. Clin. Cancer Res. 18:2740.
3. Navid F, et al. 2010. Curr. Cancer Drug Targets. 10:200.

Gene ID
2583 View all products for this Gene ID
UniProt
View information about Ganglioside GD2 on UniProt.org
Go To Top Version: 1    Revision Date: 02/05/2024

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account