- Clone
- 14G2a (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Disialoganglioside GD2, Ganglioside G2
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TACGCAACTTCATTG
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
357329 | 10 µg | $369.00 |
Ganglioside GD2 is a sialic acid-containing glycosphingolipid involved in cell attachment to the extracellular matrix. Expression of GD2 in normal tissue is restricted to cells from the central nervous system, peripheral nerves, skin melanocytes, and mesenchymal stem cells. However GD2 is highly expressed by tumors of neuro-ectodermal origin such as melanomas, gliomas, neuroblastomas, and small cell lung carcinoma. GD2 has been proposed as a marker for some cancer stem cells.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Neuroblastoma cell line LAN-1
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone 14G2a is an isotype switch variant from parental hybridoma 14.18 (IgG3)1. Additional reported applications (for the relevant formats) include: inducing apoptosis and enhancing cytotoxicity of chemotherapeutic drugs in the neuroblastoma cell line 2. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for use in cytotoxic and apoptotic studies (contact our custom solutions team). This clone has also been published as 14.G2a.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Mujoo K, et al. 1989. Cancer Res. 49:2857. (Cyt)
- Kowalczyk A, et al. 2009. Cancer Lett. 281:171. (Apop, Cyt)
- Battula VL, et al. 2012. J. Clin. Invest. 122:2066. (FC)
- RRID
-
AB_3097619 (BioLegend Cat. No. 357329)
Antigen Details
- Distribution
-
Neurons, mesenchymal stem cells, highly expressed in tumors of neuro-ectodermal origin, such as melanomas, gliomas, neuroblastomas, and small cell lung carcinoma
- Function
- Cell attachment to extracellular matrix
- Cell Type
- Mesenchymal cells, Neurons
- Biology Area
- Apoptosis/Tumor Suppressors/Cell Death, Cell Adhesion, Cell Biology, Immunology, Neuroscience
- Molecular Family
- Adhesion Molecules
- Antigen References
-
1. Tarek N, et al. 2012. J. Clin. Invest. 122:3260.
2. Matthay KK, et al. 2012. Clin. Cancer Res. 18:2740.
3. Navid F, et al. 2010. Curr. Cancer Drug Targets. 10:200. - Gene ID
- 2583 View all products for this Gene ID
- UniProt
- View information about Ganglioside GD2 on UniProt.org
Other Formats
View All Ganglioside GD2 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human Ganglioside GD2 | 14G2a | FC |
PE anti-human Ganglioside GD2 | 14G2a | FC |
APC anti-human Ganglioside GD2 | 14G2a | FC |
PE/Cyanine7 anti-human Ganglioside GD2 | 14G2a | FC |
Biotin anti-human Ganglioside GD2 | 14G2a | FC |
PerCP/Cyanine5.5 anti-human Ganglioside GD2 | 14G2a | FC |
FITC anti-human Ganglioside GD2 | 14G2a | FC |
Brilliant Violet 510™ anti-human Ganglioside GD2 | 14G2a | FC |
Alexa Fluor® 647 anti-human Ganglioside GD2 | 14G2a | FC |
PE/Dazzle™ 594 anti-human Ganglioside GD2 | 14G2a | FC |
APC/Fire™ 750 anti-human Ganglioside GD2 | 14G2a | FC |
APC/Cyanine7 anti-human Ganglioside GD2 | 14G2a | FC |
Brilliant Violet 421™ anti-human Ganglioside GD2 | 14G2a | FC |
TotalSeq™-C1456 anti-human Ganglioside GD2 | 14G2a | PG |
TotalSeq™-A1456 anti-human Ganglioside GD2 | 14G2a | PG |
TotalSeq™-B1456 anti-human Ganglioside GD2 | 14G2a | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human Ganglioside GD2
-
PE anti-human Ganglioside GD2
-
APC anti-human Ganglioside GD2
-
PE/Cyanine7 anti-human Ganglioside GD2
-
Biotin anti-human Ganglioside GD2
-
PerCP/Cyanine5.5 anti-human Ganglioside GD2
-
FITC anti-human Ganglioside GD2
-
Brilliant Violet 510™ anti-human Ganglioside GD2
-
Alexa Fluor® 647 anti-human Ganglioside GD2
-
PE/Dazzle™ 594 anti-human Ganglioside GD2
-
APC/Fire™ 750 anti-human Ganglioside GD2
-
APC/Cyanine7 anti-human Ganglioside GD2
-
Brilliant Violet 421™ anti-human Ganglioside GD2
-
TotalSeq™-C1456 anti-human Ganglioside GD2
-
TotalSeq™-A1456 anti-human Ganglioside GD2
-
TotalSeq™-B1456 anti-human Ganglioside GD2