- Clone
- 1B4C3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- erbB-3, erbB3, HER-3, HER3
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- AGTTTCCTCCGAATT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
324711 | 10 µg | $369.00 |
The 1B4C3 monclonal antibody recognizes human erbB3/HER3 also know as oncogene erbB3, tyrosine kinase cell surface receptor HER3, and C-erbB3. erbB3/HER3 is a receptor tyrosine kinase and a member of the epidermal growth factor receptor family. erbB3/HER3 binds the heregulin ligands and contains 4 furin-like repeats, 2 cheY receiver domains, and a tyrosine kinase domain with a predicted molecular weight approximately 148 kD. Signaling through the erbB3/HER3 receptor induces proliferation and differentiation in some cell types, the receptor is widely expressed in many tissues including kidney, lung, brain, placenta, skin and stomach. erbB3/HER3 forms constitutively active heterodimers with erbB2/HER2 in a subset of human mammary tumors; expression of erbB3/HER3 reported be linked to favorable outcome in bladder and ovarian cancer. erbB3/HER3 has been shown to interact with a number of proteins including EGF receptor, erbB2/HER2, erbB4, Grb2, Grb7, SOS1, cdk5, SHC, FAK, PTK6, and others. The erb3/HER3 receptor is extensively phosphorylated at residues T873 and S1123 (by cdk5); Y1199, Y1262, Y1289, and Y1328. The 1B4C3 antibody has been shown to be useful for flow cytometric detection of human erbB3/HER3.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- NIH-3T3 cells transfected with human erbB3/HER3
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. - RRID
-
AB_3106267 (BioLegend Cat. No. 324711)
Antigen Details
- Structure
- Member of the epidermal growth factor receptor family. A receptor tyrosine kinase containing 4 furin-like repeats, 2 cheY receiver domains, and a tyrosine kinase domain. Predicted molecular weight approximately 148 kD
- Distribution
-
Widely expressed in many tissues including kidney, lung, brain, placenta, skin and stomach. Forms constitutively active heterodimers with erbB2/HER2 in a subset of human mammary tumors; expression of erbB3/HER3 reported be linked to favorable outcome in b
- Function
- Induces extensive signaling cascade that can regulate growth and possibly differentiation
- Ligand/Receptor
- Heregulin
- Modification
- Extensively phosphorylated T873 and S1123 (by cdk5); Y1199, Y1262, Y1289, Y1328
- Biology Area
- Cancer Biomarkers, Cell Biology, Immunology, Neuroscience, Synaptic Biology
- Molecular Family
- Adhesion Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Carraway KL, et al. 1994. J. Biol. Chem. 269:14303.
2. Kraus MH, et al. 1989. Proc. Natl. Acad. Sci. USA 86:9193.
3. Chan SD, et al. 1995. J. Biol. Chem. 270:22608.
4. Tanner B, et al. 2006. J. Clin. Oncol. (Epub Aug. 8 2006) - Gene ID
- 2065 View all products for this Gene ID
- UniProt
- View information about erbB3/HER-3 on UniProt.org
Other Formats
View All Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human erbB3/HER-3 | 1B4C3 | FC,ICC |
Biotin anti-human erbB3/HER-3 | 1B4C3 | FC |
PE anti-human erbB3/HER-3 | 1B4C3 | FC |
APC anti-human erbB3/HER-3 | 1B4C3 | FC |
PE/Cyanine7 anti-human erbB3/HER-3 | 1B4C3 | FC |
TotalSeq™-A1469 anti-human erbB3/HER-3 | 1B4C3 | PG |
TotalSeq™-C1469 anti-human erbB3/HER-3 | 1B4C3 | PG |
TotalSeq™-B1469 anti-human erbB3/HER-3 | 1B4C3 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.