TotalSeq™-D0351 anti-human CD135 (Flt-3/Flk-2) Antibody

Product Details

Verified Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

BV-173 pro-B cell line

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID

AB_2922546 (BioLegend Cat. No. 313325)

Antigen Details

Structure

Member of the immunoglobulin supergene family, type 3 tyrosine kinase receptor; 130-160 kD

Distribution

Expressed on CD34⁺ hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. Also expressed on AML, ALL and CML-BC tumor cells

Function

Tyrosine kinase growth factor receptor involved in the growth and differentiation of primitive hematopoietic cells

Ligand/Receptor

FLT3 ligand

Cell Type

B cells, Hematopoietic stem and progenitors, Leukemia, Thymocytes

Biology Area

Cell Biology, Immunology

Molecular Family

CD Molecules, Cytokine/Chemokine Receptors

Antigen References

1. Rappold I, et al. 1997. Blood 90:111.
2. Rosnet O, et al. 1996. Acta Haematol. 95:218.
3. Rosnet O, et al. 1996. Leukemia 10:238.
4. Bertho JM, et al. 2000. Scand. J. Immunol. 52:53.

Gene ID

2322 View all products for this Gene ID

UniProt

View information about CD135 on UniProt.org

Related Protocols

• TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Other Formats