- Regulatory Status
- RUO
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 399911 | 200K Cells | $7300.00 | |||
| 399912 | 1.2M Cells | $17800.00 | |||
The TotalSeq™-A PhenoCyte Human Universal V1.0 Kit provides an end-to-end solution for high-throughput, high-parameter single-cell protein analysis. This kit combines BioLegend’s pre-titrated, optimized TotalSeq™-A antibody cocktails with Scale Biosciences’ Quantum Barcoding single-cell technology to enable precise multiplexing of hundreds of protein markers from 200,000 (Cat. No. 399911) or 1.2 million (Cat. No. 399912) single-cells. Designed for scalability and efficiency, the kit provides a streamlined, instrument-free workflow to obtain high-sensitivity, low-background data: capable of detecting rare cell populations with frequencies as low as 1 in 10,000 cells. The TotalSeq™-A Phenocyte Human Universal V1.0 Kit has been designed to assess 154 unique cell surface antigens, including principal lineage antigens, and includes 9 isotype control antibodies.
Product Details
- Verified Reactivity
- Human
- Formulation
-
TotalSeq™-A PhenoCyte - Module A
• Sample Indexing Oligos
TotalSeq™-A PhenoCyte - Module B
• GFL Additive
• GFL Buffer A
• GFL Buffer B
• GFL Enzyme A
• GFL Enzyme B
• PCR Master Mix
• Library Oligos
TotalSeq™-A PhenoCyte - Module C: Human Universal, V1.0
• Quantum Barcoding Protein Beads
• Wetting Buffer
• Hyb Buffer A
• Purification Buffer
• Hyb Buffer B
• Bead Collection Buffer
• Treatment Solution
• Sample Collection Funnel
• Quantum Barcoding Plate
• TotalSeq™-A Human Universal Cocktail, V1.0 (1x or 6x rxns)
Antibody Cocktails: Lyophilized from PBS containing stabilizers. Please reconstitute each tube with cell staining buffer as indicated in the User Manual when ready to use. Make sure the cake is completely dissolved prior to using the cocktail for staining cells. The lyophilized cocktail material can vary in appearance and appear as either a lyophilized cake or a powder - Preparation
-
Antibody Cocktail: This reagent is a combination of TotalSeq™-A oligo conjugated clones at optimal concentrations for single-cell sequencing analysis. See Additional Product Notes for a list of clones.
Phenocyte Reagents: These reagents are designed to work in tandem with TotalSeq™-A antibodies for single-cell sequencing analysis. - Storage & Handling
-
PhenoCyte Modules A and B should be stored between -30°C to -10°C.
Module C should be stored between 2°C and 8°C.
Antibody Cocktail (included in Module C): The lyophilized antibody cocktail should be stored between 2°C and 8°C in powder form and in a sealed container with desiccant until ready to use. Once vial is opened, it is to be reconstituted immediately. After reconstitution, the cocktail should be used within 2 hours. - Application
-
PG - Quality tested
- Recommended Usage
-
For detailed instructions on the use of the TotalSeq™-A PhenoCyte Human Universal, V1.0 kit please reference the respective User Manual:
Cat. No. 399911 TotalSeq PhenoCyte 200K Reagent Kits – User Manual
Cat. No. 399912 TotalSeq PhenoCyte 1.2M Reagent Kits - User Manual
This kit has been optimized on human PBMCs. Using lysed whole blood or additional TotalSeq™ antibodies may require further optimization. Please contact our technical service group for further information.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The TotalSeq™-A PhenoCyte Human Universal V1.0 Kit combines BioLegend’s TotalSeq™-A antibody Cocktails with Scale BioSciences’ Quantum Barcoding technology to immunophenotype 200,000 or 1.2 million single-cells without the need for specialized cell partitioning instrumentation. For detailed information about the use of this kit or data processing/analysis, please see https://biolegend.com/enus/totalseq/phenocyte
This kit includes the TotalSeq™-A Human Universal Cocktail, V1.0 which targets 154 unique cell surface antigens, including principal lineage antigens, and 9 isotype control antibodies. The pre-titrated lyophilized cocktail provides the convenience of reducing inconsistencies associated with pipetting and handling multiple vials and samples. The antibodies in the cocktail are provided at optimized concentrations to provide a ready-to-use solution once the cocktail has been reconstituted, eliminating the need for time-consuming rounds of titration and testing. The TotalSeq™-A Human Universal Cocktail is included in the PhenoCyte kit in convenient single-use vials; either 1 vial or 6 vials are included depending on the kit size.
This kit is made in collaboration with Scale BioSciences, utilizing their Quantum Barcoding technology for massively parallelized barcoding enabling single-cell analysis with TotaSeq™-A antibodies. - Additional Product Notes
-
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A. B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA[Barcode]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.
Download the excel file for a full list of clones and barcodes.
If you have additional questions, please reach out to BioLegend Technical Services.
Antigen Details
- Gene ID
- NA