- Clone
- WM59 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V P025
- Other Names
- PECAM-1, EndoCAM
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ACCTTTATGCCACGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
303151 | 10 µg | 296€ |
CD31 is a 130-140 kD type I transmembrane glycoprotein also known as platelet endothelial cell adhesion molecule-1 (PECAM-1) or Endocam. It is expressed on monocytes, platelets, granulocytes, endothelial cells and lymphocyte subsets. CD31 has been reported to bind CD38 and be involved in wound healing, angiogenesis, and cellular migration in an inflammatory situation.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone WM59 has been reported to recognize the D2 extracellular portion of CD31.
Additional reported applications (for the relevant formats) include: immunofluorescence microscopy2, immunohistochemical staining of acetone-fixed frozen tissue sections8, blocking of platelet aggregation3, and spatial biology (IBEX)11,12. Clone WM59 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303143 & 303144).
The purified WM59 antibody is useful as a capture antibody for a sandwich ELISA assay, when used in conjunction with biotin anti-human CD31 antibody (Cat. No. 536604) antibody as the detection antibody. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V Oxford University Press. New York.
- Muczynski KA, et al. 2003. J. Am. Soc. Nephrol. 14:1336. (IF)
- Wu XW, et al. 1997. Arterioscl. Throm. Vas. 17:3154. (Block)
- Nagano M, et al. 2007. Blood 110:151. (FC) PubMed
- MacFadyen JR, et al. 2005. FEBS Lett. 579:2569. PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
- Wicki A, et al. 2012. Clin. Cancer Res. 18:454. (FC, IHC) PubMed
- Oeztuerk-Winder F, et al. 2012. EMBO J. 31:3431. (FC) PubMed
- Bushway ME, et al. 2014. Biol Reprod. 90(5): 110 (IF) PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2922535 (BioLegend Cat. No. 303151)
Antigen Details
- Structure
- Ig superfamily, type I transmembrane glycoprotein, 130-140 kD
- Distribution
-
Monocytes, platelets, granulocytes, endothelial cells, lymphocyte subset
- Function
- Cell adhesion, signal transduction
- Ligand/Receptor
- CD38
- Cell Type
- Endothelial cells, Granulocytes, Lymphocytes, Monocytes, Neutrophils, Platelets
- Biology Area
- Angiogenesis, Cell Adhesion, Cell Biology, Immunology, Neuroinflammation, Neuroscience
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
- DeLisser H, et al. 1994. Immunol. Today 15:490.
- Newman P, 1997. J. Clin. Invest. 99:3.
- Fawcett J, et al. 1995. J. Cell Biol. 128:1229.
- Gene ID
- 5175 View all products for this Gene ID
- UniProt
- View information about CD31 on UniProt.org
Other Formats
View All CD31 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD31
Human peripheral blood lymphocytes, monocytes and granulocyt... -
PE anti-human CD31
Human peripheral granulocytes were stained with CD31 (clone ... Confocal image of human spleen sample acquired using the IBE... Confocal image of human lymph node sample acquired using the... Confocal image of human jejunum sample acquired using the IB... -
Purified anti-human CD31
Human peripheral blood lymphocytes, monocytes and granulocyt... HUVEC cells were fixed with 1% paraformaldehyde (PFA) and bl... -
Alexa Fluor® 488 anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
Alexa Fluor® 647 anti-human CD31
Human peripheral blood lymphocytes, monocytes and granulocyt... -
Pacific Blue™ anti-human CD31
Human peripheral blood monocytes were stained with CD31 (clo... -
APC anti-human CD31
Human peripheral blood lymphocytes, monocytes and granulocyt... -
PE/Cyanine7 anti-human CD31
Human peripheral blood lymphocytes, monocytes and granulocyt... -
APC/Cyanine7 anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
Brilliant Violet 605™ anti-human CD31
Human peripheral blood granulocytes were stained with anti-h... -
Brilliant Violet 421™ anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
Purified anti-human CD31 (Maxpar® Ready)
Human PBMCs stained with 154Sm-anti-CD45 (HI30) and 145Nd-an... -
Alexa Fluor® 594 anti-human CD31
HUVEC human endothelial cells were fixed with 1% paraformald... -
PE/Dazzle™ 594 anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
PerCP/Cyanine5.5 anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
Alexa Fluor® 700 anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... Confocal image of human lymph node sample acquired using the... -
Brilliant Violet 711™ anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
TotalSeq™-A0124 anti-human CD31
-
TotalSeq™-C0124 anti-human CD31
-
APC/Fire™ 750 anti-human CD31
Human peripheral blood granulocytes were stained with CD31 (... -
Ultra-LEAF™ Purified anti-human CD31
Human peripheral blood lymphocytes, monocytes and granulocyt... -
TotalSeq™-B0124 anti-human CD31
-
Brilliant Violet 785™ anti-human CD31
Human peripheral blood granulocytes were stained with anti-h... -
PE/Cyanine5 anti-human CD31
Human peripheral blood granulocytes were stained with PE/Cya... -
TotalSeq™-D0124 anti-human CD31
-
PE/Fire™ 700 anti-human CD31
Human peripheral blood granulocytes were stained with anti-h... -
Spark YG™ 581 anti-human CD31
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 510™ anti-human CD31
Human peripheral blood lymphocytes were surface stained with... -
Spark Red™ 718 anti-human CD31 (Flexi-Fluor™)
Follow Us