TotalSeq™-D0128 anti-human CD140a (PDGFRα) Antibody

Pricing & Availability
Clone
16A1 (See other available formats)
Regulatory Status
RUO
Other Names
Platelet-derived growth factor receptor, alpha polypeptide, PDGFR2, PDGFRα, PDGFRa, PDGF receptor alpha
Isotype
Mouse IgG1, κ
Barcode Sequence
ATGCGCCGAGAATTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
323517 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The 16A1 monoclonal antibody recognizes human CD140a also known as the platelet-derived growth factor receptor, alpha polypeptide, PDGFR2, and PDGFRα. CD140a is a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR-α and -β. CD140a contains three immunoglobulin-like domains and a tyrosine kinase domain with a predicted molecular weight of approximately 123 kD. CD140a is widely expressed on a variety of mesenchymal-derived cells and has been implicated in the development of some tumors including basal cell carcinoma and gastric stromal cell tumors. Binding of A-chain containing PDGF molecules as well as protease-activated PDGF-C molecules can stimulate cell proliferation. CD140a has been shown to interact with a number of proteins including CRK, Grb2, Grb14, SHP2, and others as integrin β3, caveolin-1, and nexin sorting molecules. The PDGFRα is heavily phosphorylated on numerous tyrosine residues through both autophosphorylation and ligand-dependent processes. The 16A1 antibody has been shown to be useful for flow cytometric detection of CD140a.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
NIH 3T3 cells transfected with human PDGFRalpha
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Miyazaki S et al. In:Leukocyte Typing VI Kishimoto et al. Eds, Garland Publishing Inc, New York 1998 pp 3-20.
  2. Lottaz C, et al. 2010. Cancer Res. 70:2030. PubMed
  3. Ricono JM, et al. 2009. Am. J. Physiol. Renal Physiol. 296:F406. (IF)
  4. Guarnerio J, et al. 2015. Cancer Discov. 5:396. PubMed
RRID
AB_2927874 (BioLegend Cat. No. 323517)

Antigen Details

Structure
Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family.
Distribution

Widely expressed on a variety of mesenchymal-derived cells.

Function
Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Knock-out studies have implicated an essential role for CD140a in kidney development. Has been implicated in basal cell carcinoma and gastric stromal cell tumors.
Interaction
Interacts with Crk, as well as a variety of adaptor molecules and signaling intermediates (Grb2, Grb14, SHP2, others). Has also been shown to associate with integrin β3, caveolin-1, and nexin sorting molecules
Ligand/Receptor
Binds to A-chain containing PDGF molecules and protease-activated PDGF-C molecules
Modification
Multiple tyrosine phosphorylation sites (Y720, Y731, Y742, Y754, Y762, Y767, Y768, Y988, Y993, Y1018)
Cell Type
Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells, Neural Stem Cells
Biology Area
Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435.
2. Gilbertson DG, et al. 2001. J. Biol. Chem. 276:27406.
3. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771.
4. Rupp E, et al. 1994. Eur. J. Biochem. 225:29.

Gene ID
5156 View all products for this Gene ID
UniProt
View information about CD140a on UniProt.org
Go To Top Version: 1    Revision Date: 09.07.2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account