- Clone
- J252D4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- BLR1, MDR15
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AATTCAACCGTCGCC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
356949 | 10 µg | 296€ |
CD185, also known as CXCR5, is a 42 kD G-protein coupled receptor with seven transmembrane regions. CXCR5 is expressed by mature B cells, follicular helper T cells, Burkitt’s lymphoma cells and a subset of neurons, and mediates cell migration to the B cell follicles in the secondary lymphoid organs. The ligand of CXCR5 is CXCL13 (BLC).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human CXCR5-transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894546 (BioLegend Cat. No. 356949)
Antigen Details
- Structure
- G-protein coupled receptor, 7 transmembrane regions, 42 kD
- Distribution
-
Mature B cells, Follicular helper T cells, and Burkitt's lymphoma cells.
- Function
- Mediates cell migration to the B cell follicles in the secondary lymphoid organs
- Ligand/Receptor
- CXCL13
- Cell Type
- B cells, Tfh
- Biology Area
- Cell Biology, Immunology, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, GPCR
- Antigen References
-
1. Ma CS, et al. 2012. J. Exp. Med. 209:1241.
2. León B, et al. 2012. Nat. Immunol. 13:681.
3. Crotty S. 2011. Annu. Rev. Immunol. 29:621.
4. Kerfoot SM, et al. 2011. Immunity 34:947.
5. Sáez de Guinoa J, et al. 2011. Blood 118:1560. - Gene ID
- 643 View all products for this Gene ID
- UniProt
- View information about CD185 on UniProt.org
Related FAQs
- Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
-
Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.
Other Formats
View All CD185 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
APC anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
Purified anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with purifie... -
Alexa Fluor® 647 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
PerCP/Cyanine5.5 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
Alexa Fluor® 488 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
FITC anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
Alexa Fluor® 700 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
Pacific Blue™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
Brilliant Violet 421™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 Al... -
PE/Cyanine7 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
APC/Cyanine7 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
PE/Dazzle™ 594 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
Brilliant Violet 605™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
Biotin anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
Brilliant Violet 711™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
Brilliant Violet 785™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 AP... -
TotalSeq™-A0144 anti-human CD185 (CXCR5)
-
TotalSeq™-C0144 anti-human CD185 (CXCR5)
-
Brilliant Violet 750™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with CD19 FI... -
TotalSeq™-B0144 anti-human CD185 (CXCR5)
-
APC/Fire™ 750 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes stained with CD19 Pacific... -
Spark NIR™ 685 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes stained with CD19 PE and ... -
TotalSeq™-D0144 anti-human CD185 (CXCR5)
-
PE/Cyanine5 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 700 anti-human CD185 (CXCR5) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 810 anti-human CD185 (CXCR5) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
APC anti-human CD185
Typical results from human peripheral blood lymphocytes stai... -
Brilliant Violet 510™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 650™ anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE anti-human CD185
Typical results from human peripheral blood lymphocytes stai... -
PE/Fire™ 744 anti-human CD185 (CXCR5) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
StarBright UltraViolet 795 anti-human CD185 (CXCR5)
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us