- Clone
- 11A8 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- DNAM-1, PTA1, TLiSA1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCTCAGTGTTTGTGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
338341 | 10 µg | 296€ |
DNAM-1 (CD226) is a ~65 kD glycoprotein expressed on cell surface of T cells, NK cells, monocytes/macrophages, platelets and megakaryocytes and a subset of B cells and a member of the immunoglobulin (Ig)-superfamily containing 2 Ig-like domains of the V-set. The ligands for CD226 are the poliovirus receptor (CD155) and its family member nectin-2 (CD112), which are broadly expressed on epithelial, endothelial and neuronal cells. CD226 is physically associated with LFA-1 in NK cells and activated T cells, and involved in LFA-1-mediated signaling.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: block NK cell-mediated lysis.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Fuchs A, et al. 2004. J. Immunol. 172:3994.
- RRID
-
AB_2894624 (BioLegend Cat. No. 338341)
Antigen Details
- Structure
- Ig domain containing adhesion molecule
- Distribution
-
Peripheral blood T cells, NK cells, monocytes/macrophages, platelets and megakaryocytes and a subset of B cells
- Function
- Receptor involved in intercellular adhesion, lymphocyte signaling, cytotoxicity and lymphokine secretion mediated by cytotoxic T-lymphocyte (CTL) and NK cell
- Interaction
- Interacts with LFA-1.
- Ligand/Receptor
- PVR (CD155) and Nectin-2 (CD112)
- Cell Type
- B cells, Macrophages, Megakaryocytes, Monocytes, NK cells, Platelets, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Shibuya A et al. 1996. Immunity 4:573.
2. Tahara-Hanaoka S et al. 2004. Int. Immunol. 16:533.
3. Pende D et al. 2005. Mol. Immunol. 42:463. - Gene ID
- 10666 View all products for this Gene ID
- UniProt
- View information about CD226 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD226 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD226 (DNAM-1) | 11A8 | FC |
FITC anti-human CD226 (DNAM-1) | 11A8 | FC |
PE anti-human CD226 (DNAM-1) | 11A8 | FC |
APC anti-human CD226 (DNAM-1) | 11A8 | FC |
PerCP/Cyanine5.5 anti-human CD226 (DNAM-1) | 11A8 | FC |
PE/Cyanine7 anti-human CD226 (DNAM-1) | 11A8 | FC |
APC/Fire™ 750 anti-human CD226 (DNAM-1) | 11A8 | FC |
Brilliant Violet 785™ anti-human CD226 (DNAM-1) | 11A8 | FC |
Brilliant Violet 605™ anti-human CD226 (DNAM-1) | 11A8 | FC |
PE/Dazzle™ 594 anti-human CD226 (DNAM-1) | 11A8 | FC |
Biotin anti-human CD226 (DNAM-1) | 11A8 | FC |
Brilliant Violet 510™ anti-human CD226 (DNAM-1) | 11A8 | FC |
Alexa Fluor® 647 anti-human CD226 (DNAM-1) | 11A8 | FC |
Brilliant Violet 421™ anti-human CD226 (DNAM-1) | 11A8 | FC |
Brilliant Violet 711™ anti-human CD226 (DNAM-1) | 11A8 | FC |
TotalSeq™-A0368 anti-human CD226 (DNAM-1) | 11A8 | PG |
TotalSeq™-C0368 anti-human CD226 (DNAM-1) | 11A8 | PG |
TotalSeq™-B0368 anti-human CD226 (DNAM-1) | 11A8 | PG |
TotalSeq™-D0368 anti-human CD226 (DNAM-1) | 11A8 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 APC... -
FITC anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 APC... -
PE anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 Bri... -
APC anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 Bri... -
PerCP/Cyanine5.5 anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 Bri... -
PE/Cyanine7 anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 Bri... -
APC/Fire™ 750 anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 Bri... -
Brilliant Violet 785™ anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 605™ anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Dazzle™ 594 anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 Bri... -
Biotin anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Brilliant Violet 510™ anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Alexa Fluor® 647 anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 421™ anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Brilliant Violet 711™ anti-human CD226 (DNAM-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
TotalSeq™-A0368 anti-human CD226 (DNAM-1)
-
TotalSeq™-C0368 anti-human CD226 (DNAM-1)
-
TotalSeq™-B0368 anti-human CD226 (DNAM-1)
-
TotalSeq™-D0368 anti-human CD226 (DNAM-1)
Follow Us