TotalSeq™-D0594 anti-human CD133 Antibody

Pricing & Availability
Clone
S16016B (See other available formats)
Regulatory Status
RUO
Other Names
Prominin-1, PROM1, AC133
Isotype
Mouse IgG2a, κ
Barcode Sequence
GTAAGACGCCTATGC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
394019 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD133, also known as Prominin-1 and AC133 antigen, is a 120 kD pentaspan glycoprotein with 5 transmembrane domains. CD133 was initially described as a surface antigen specific for human hematopoietic stem cells and as a marker for murine neuroepithelial cells and some embryonic epithelia. Later on, CD133 was found on other stem cells, including endothelial progenitor cells, glioblastomas, neuronal, and glial stem cells. In addition to stem cells for normal tissue, CD133 was found on cancer cells, such as some leukemia cells and brain tumor cells. Although the biological function of CD133 is not completely understood, CD133 has been extensively used as a stem cell marker for normal and cancerous tissues.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human CD133 transfectants
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

In-house testing suggests that clone S16016B blocks clone AC133 but not clone 7 that are also raised against human CD133.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2910453 (BioLegend Cat. No. 394019)

Antigen Details

Structure
120 kD pentaspan transmembrance glycoprotein with 5 transmembrane domains
Distribution

Hematopoietic stem cells and progenitor cells, fetal liver cells, tissue specific stem cells or progenitor cells such as renal and prostate, a variety of tumor cells

Function
May play a role in cell differentiation, proliferation, and apoptosis
Interaction
NAT8; NAT8B; CDHR1
Cell Type
Hematopoietic stem and progenitors
Biology Area
Cancer Biomarkers, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References
  1. Yin AH, et al. 1997. Blood. 90:5002.
  2. Miraglia S, et al. 1997. Blood. 90:5013.
  3. Bühring HJ, et al. 1999. Ann. NY Acad. Sci. 872:25.
Gene ID
8842 View all products for this Gene ID
UniProt
View information about CD133 on UniProt.org
Go To Top Version: 1    Revision Date: 03.07.2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account