Loading...

TotalSeq™-D1018 anti-human HLA-DR, DP, DQ Antibody

Pricing & Availability
Clone
Tü39 (See other available formats)
Regulatory Status
RUO
Other Names
MHC class II, Major Histocompatibility complex II, human leukocyte antigen, HLA
Isotype
Mouse IgG2a, κ
Barcode Sequence
AGCTACGAGCAGTAG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
361719 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

HLA-DR, HLA-DP, and HLA-DQ are heterodimeric cell surface glycoproteins comprised of an α (heavy) chain and a β (light) chain. They are expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In conjunction with the CD3/TCR complex and CD4 molecules, HLA-DR is critical for efficient peptide presentation to CD4+ T cells. Variations in the HLA gene expression are crucial to graft survival.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Baboon, Cynomolgus, Cat, Dog, Cow
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human PBL
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Tü39 has been reported to react with a shared epitope of HLA-DR, HLA-DP, and HLA-DQ.

Additional reported applications (of relevant formats) include immunoprecipitation6, in vitro blocking of MLR5, and suppressor cell generation4. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Pawelec G, et al. 1985. Hum. Immunol. 12:165.
  2. Shaw S, et al. 1985. Hum. Immunol. 12:191.
  3. Ziegler A, et al. 1986. Immunobiology 171:77.
  4. Pawelec G, et al. 1986. Hum. Immunol. 17:343. (Block)
  5. Dai Z, et al. 2009. J. Exp. Med. 206:793. (Block)
  6. Pawelec G, et al. 1988. J. Exp. Med. 167:243. (IP)
RRID
AB_2922573 (BioLegend Cat. No. 361719)

Antigen Details

Structure
Ig superfamily, MHC class II, heterodimeric transmembrane protein
Distribution

B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs

Function
Antigen presentation
Ligand/Receptor
CD3/TCR, CD4
Cell Type
Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Thorsby E. 1974. Transplant. Rev. 18:51.
2. Qvigstad E, et al. 1984. Hum. Immunol. 11:207.
3. Servenius B, et al. 1984. EMBO J. 3:3209.
4. Ottenhoff TH, et al. 1985. Hum. Immunol. 13:105.
5. Strassmann G, et al. 1985. Hum. Immunol. 13:125.
6. Trowsdale J, et al. 1985. Immunol Rev. 85:5.

Gene ID
3122 View all products for this Gene ID 3123 View all products for this Gene ID 3113 View all products for this Gene ID 3115 View all products for this Gene ID 3117 View all products for this Gene ID 3119 View all products for this Gene ID
UniProt
View information about HLA-DR DP DQ on UniProt.org
Go To Top Version: 1    Revision Date: 03.18.2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account