- Clone
- DJR2-4 (7-8) (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- TRAIL-R2, KILLER, TRICK2, TNFRSF10B, Ly98, CD262
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TTGGCCTGTAGAAAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
307413 | 10 µg | 296€ |
DR5 is 55 kD member 10B of the TNF receptor superfamily (TNFRSF10B), also known as TRAIL-R2, TRICK2, KILLER, and CD262. It binds the cytotoxic ligand TRAIL and induces apoptosis. The DR5 receptor is broadly expressed on a variety of normal tissues and many tumors. DR5 expression has been reported to be upregulated in human cells by interferon-α, 2-methoxyestradiol, and paclitaxel, and downregulated by adenoviral E3 proteins.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Extracellular domain of DR5-human IgG1 Fc fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Uno K, et al. 2003. Blood 101:3658.
- Sato K, et al. 2005. J. Immunol. 174:4025.
- Lundgvist A,et al.2006.Cancer Res.14:7317.PubMed
- RRID
-
AB_3068121 (BioLegend Cat. No. 307413)
Antigen Details
- Structure
- TNFR superfamily, 55 kD
- Distribution
-
Broadly expressed on normal and tumor cells
- Function
- Induces apoptosis
- Ligand/Receptor
- TRAIL
- Biology Area
- Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. MacFarlane M, et al. 1997. J. Biol. Chem. 272:25417.
2. Walczak H, et al. 1997. EMBO J. 16:5386.
3. Shigeno M, et al. 2003. Oncogene 22:1653.
4. LaVallee T, et al. 2003. Cancer Res. 63:468.
5. Nimmanapalli R, et al. 2001. Cancer Res. 61:759 - Gene ID
- 8795 View all products for this Gene ID
- UniProt
- View information about CD262 on UniProt.org
Other Formats
View All CD262 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD262 (DR5, TRAIL-R2) | DJR2-4 (7-8) | FC |
Purified anti-human CD262 (DR5, TRAIL-R2) | DJR2-4 (7-8) | FC |
APC anti-human CD262 (DR5, TRAIL-R2) | DJR2-4 (7-8) | FC |
TotalSeq™-B1182 anti-human CD262 (DR5, TRAIL-R2) Antibody | DJR2-4 (7-8) | PG |
TotalSeq™-A1182 anti-human CD262 (DR5, TRAIL-R2) | DJR2-4 (7-8) | PG |
TotalSeq™-D1182 anti-human CD262 (DR5, TRAIL-R2) | DJR2-4 (7-8) | PG |
TotalSeq™-C1182 anti-human CD262 (DR5, TRAIL-R2) | DJR2-4 (7-8) | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD262 (DR5, TRAIL-R2)
Human DR5 transfected cells stained with DJR2-4 PE -
Purified anti-human CD262 (DR5, TRAIL-R2)
Human peripheral blood lymphocytes stained with purified DJR... -
APC anti-human CD262 (DR5, TRAIL-R2)
Human DR5-transfected cells stained with DJR2-4 APC -
TotalSeq™-B1182 anti-human CD262 (DR5, TRAIL-R2) Antibody
-
TotalSeq™-A1182 anti-human CD262 (DR5, TRAIL-R2)
-
TotalSeq™-D1182 anti-human CD262 (DR5, TRAIL-R2)
-
TotalSeq™-C1182 anti-human CD262 (DR5, TRAIL-R2)
Follow Us