- Clone
- DJR1 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- TRAIL-R1, Apo-2, CD261, TNFRSF10A
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCCCTTCCTCATTTC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
307213 | 10 µg | 296€ |
DR4 is 56 kD member 10A of the TNFR superfamily (TNFRSF10A), also known as TRAIL-R1, Apo-2, and CD261. It is expressed at low levels by activated T cells and some tumors. After TRAIL engagement, DR4 (TRAIL-R1), through activation of NF-κB, induces apoptosis in the TRAIL ligated cell.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Extracellular domain of DR4-human IgG1 Fc fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: The DJR1 antibody is useful for immunofluorescent staining and flow cytometric analysis of DR4/TRAIL-R1 receptor expression. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 307206) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated antibody or biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by SAv-PE (Cat. No. 405204)).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Uno K, et al. 2003. Blood 101:3658.
- Sato K, et al. 2005. J. Immunol. 174:4025.
- Lundqvist A, et al. 2006. Cancer Res. 66:7317. PubMed
- Chen KF, et al. 2011. J Pharmacol Exp Ther. 337:155. PubMed
- Sonnemann J, et al. 2012. Cancer Biol Ther. 13:417. PubMed
- Chandrasekaran S, et al. 2014. PLoS One. 9:111487. PubMed
- RRID
-
AB_2941476 (BioLegend Cat. No. 307213)
Antigen Details
- Structure
- TNFR superfamily, 56 kD
- Distribution
-
Activated T cells, tumor cells
- Function
- Induces apoptosis
- Ligand/Receptor
- TRAIL
- Cell Type
- T cells
- Biology Area
- Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Macfarlane M. 2003. Toxicol. Lett. 139:89.
2. Baetu T, et al. 2002. Cytokine Growth Factor Rev. 13:199.
3. Degli-Esposti M. 1999. J. Leukoc. Biol. 65:535. - Gene ID
- 8797 View all products for this Gene ID
- UniProt
- View information about CD261 on UniProt.org
Related FAQs
Other Formats
View All CD261 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD261 (DR4, TRAIL-R1) | DJR1 | FC |
Purified anti-human CD261 (DR4, TRAIL-R1) | DJR1 | FC |
APC anti-human CD261 (DR4, TRAIL-R1) | DJR1 | FC |
PE/Cyanine7 anti-human CD261 (DR4, TRAIL-R1) | DJR1 | FC |
TotalSeq™-B1183 anti-human CD261 (DR4, TRAIL-R1) | DJR1 | PG |
TotalSeq™-D1183 anti-human CD261 (DR4, TRAIL-R1) | DJR1 | PG |
TotalSeq™-A1183 anti-human CD261 (DR4, TRAIL-R1) | DJR1 | PG |
TotalSeq™-C1183 anti-human CD261 (DR4, TRAIL-R1) | DJR1 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD261 (DR4, TRAIL-R1)
-
Purified anti-human CD261 (DR4, TRAIL-R1)
-
APC anti-human CD261 (DR4, TRAIL-R1)
-
PE/Cyanine7 anti-human CD261 (DR4, TRAIL-R1)
-
TotalSeq™-B1183 anti-human CD261 (DR4, TRAIL-R1)
-
TotalSeq™-D1183 anti-human CD261 (DR4, TRAIL-R1)
-
TotalSeq™-A1183 anti-human CD261 (DR4, TRAIL-R1)
-
TotalSeq™-C1183 anti-human CD261 (DR4, TRAIL-R1)
Follow Us