- Clone
- P67.6 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Siglec-3, gp67, p67
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TAACTCAGGGCCTAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
366637 | 10 µg | 369 CHF |
CD33, also known as Siglec-3, gp67, and p67, is a 67 kD type I transmembrane glycoprotein. It is a sialoadhesion immunoglobulin superfamily member, which is expressed on myeloid progenitors, monocytes, granulocytes, dendritic cells, and mast cells. CD33 is absent on normal platelets, lymphocytes, erythrocytes, and hematopoietic stem cells. CD33 functions as a sialic acid-dependent cell adhesion molecule with carbohydrate/lectin binding activity.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- FMY9S5 cells expressing CD33 gene.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Hoyer J, et al. 2008. Am. J. Clin. Pathol. 129:316.
- RRID
-
AB_2894561 (BioLegend Cat. No. 366637)
Antigen Details
- Structure
- Ig superfamily, sialoadhesins, type I glycoprotein, 67 kD
- Distribution
-
Myeloid progenitor, monocytes, granulocytes, dendritic cells, and mast cells.
- Function
- Adhesion and lectin binding activity.
- Ligand/Receptor
- Sugar chains containing sialic acid.
- Cell Type
- Dendritic cells, Granulocytes, Hematopoietic stem and progenitors, Mast cells, Monocytes
- Biology Area
- Cell Biology, Immunology, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules, Siglec Molecules
- Antigen References
-
1. Favaloro E, et al. 1988. Br. J. Haematol. 69:163.
2. Freeman S, et al. 1995. Blood 85:2005. - Gene ID
- 945 View all products for this Gene ID
- UniProt
- View information about CD33 on UniProt.org
Other Formats
View All CD33 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD33
-
Purified anti-CD33
-
APC anti-human CD33
-
PE anti-human CD33
-
Brilliant Violet 510™ anti-human CD33
-
Brilliant Violet 605™ anti-human CD33
-
APC/Cyanine7 anti-human CD33
-
PerCP/Cyanine5.5 anti-human CD33
-
PE/Cyanine7 anti-human CD33
-
FITC anti-human CD33
-
Brilliant Violet 421™ anti-human CD33
-
Biotin anti-human CD33
-
Alexa Fluor® 647 anti-human CD33
-
Brilliant Violet 711™ anti-human CD33
-
TotalSeq™-A0052 anti-human CD33
-
APC/Fire™ 750 anti-human CD33
-
TotalSeq™-C0052 anti-human CD33
-
TotalSeq™-B0052 anti-human CD33
-
TotalSeq™-D0052 anti-human CD33
-
Spark YG™ 581 anti-human CD33
-
Spark Violet™ 423 anti-human CD33
-
Spark Blue™ 574 anti-human CD33
-
Spark Red™ 718 anti-human CD33 (Flexi-Fluor™)
-
Spark Blue™ 550 anti-human CD33 (Flexi-Fluor™)
Follow Us