- Clone
- 19F2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- BCM, TNFRSF17
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CAGATGATCCACCAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
357539 | 10 µg | 369 CHF |
CD269, also known as B cell maturation antigen (BCMA), is a 27 kD, single pass transmembrane protein with one TNFR-Cys repeat on its extracellular domain. CD269 is a B cell maturation factor, essential for the long-term survival of plasma cells. It is expressed by plasmablasts, plasma cells, and germinal center B cells. The ligands of CD269 are BAFF and APRIL, and its cytoplasmic domain binds several of the TRAF family members.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- BCMA-mouse IgG Fc fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_3662390 (BioLegend Cat. No. 357539)
Antigen Details
- Structure
- Single pass transmembrane protein, member of the TNFR superfamily, 1 TNFR-Cys domain, 27 kD
- Distribution
-
Plasmablasts, plasma cells, germinal center B cells
- Function
- B cell maturation factor, essential for survival of plasma cells
- Interaction
- Associates with several TRAF family members
- Ligand/Receptor
- BAFF, APRIL
- Cell Type
- B cells, Plasma cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Coquery CM and Erickson LD. 2012. Crit. Rev. Immunol. 32:287.
2. Notas G, et al. 2012. J. Immunol. 189:4748.
3. Rickert RC, et al. 2011. Immunol. Rev. 244:115.
4. Mesin L, et al. 2011. J. Immunol. 187:2867. - Gene ID
- 608 View all products for this Gene ID
- UniProt
- View information about CD269 on UniProt.org
Related FAQs
Other Formats
View All CD269 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD269 (BCMA) | 19F2 | FC |
PE anti-human CD269 (BCMA) | 19F2 | FC |
APC anti-human CD269 (BCMA) | 19F2 | FC |
PE/Cyanine7 anti-human CD269 (BCMA) | 19F2 | FC |
PerCP/Cyanine5.5 anti-human CD269 (BCMA) | 19F2 | FC |
PE/Dazzle™ 594 anti-human CD269 (BCMA) | 19F2 | FC |
Biotin anti-human CD269 (BCMA) | 19F2 | FC |
APC/Fire™ 750 anti-human CD269 (BCMA) | 19F2 | FC |
Alexa Fluor® 647 anti-human CD269 (BCMA) | 19F2 | FC |
Brilliant Violet 421™ anti-human CD269 (BCMA) | 19F2 | FC |
TotalSeq™-A0056 anti-human CD269 (BCMA) | 19F2 | PG |
TotalSeq™-C0056 anti-human CD269 (BCMA) | 19F2 | PG |
TotalSeq™-B0056 anti-human CD269 (BCMA) | 19F2 | PG |
KIRAVIA Blue 520™ anti-human CD269 (BCMA) Antibody | 19F2 | FC |
PE/Cyanine5 anti-human CD269 (BCMA) | 19F2 | FC |
PE/Fire™ 810 anti-human CD269 (BCMA) | 19F2 | FC |
Brilliant Violet 650™ anti-human CD269 (BCMA) | 19F2 | FC |
Brilliant Violet 785™ anti-human CD269 (BCMA) | 19F2 | FC |
Brilliant Violet 605™ anti-human CD269 (BCMA) | 19F2 | FC |
TotalSeq™-D0056 anti-human CD269 (BCMA) | 19F2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with purified CD269... -
PE anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with CD269 (clone 1... -
APC anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with CD269 (clone 1... -
PE/Cyanine7 anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with CD269 (clone 1... -
PerCP/Cyanine5.5 anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with CD269 (BCMA, c... -
PE/Dazzle™ 594 anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with CD269 (clone 1... -
Biotin anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with biotinylated C... -
APC/Fire™ 750 anti-human CD269 (BCMA)
Human myeloma cell line U266 was stained with CD269 (clone 1... -
Alexa Fluor® 647 anti-human CD269 (BCMA)
Human myeloma cell line, U266, was stained with CD269 (Clone... -
Brilliant Violet 421™ anti-human CD269 (BCMA)
Human myeloma cell line, U266, was stained with CD269 (clone... -
TotalSeq™-A0056 anti-human CD269 (BCMA)
-
TotalSeq™-C0056 anti-human CD269 (BCMA)
-
TotalSeq™-B0056 anti-human CD269 (BCMA)
-
KIRAVIA Blue 520™ anti-human CD269 (BCMA) Antibody
Human myeloma cell line U266 was stained with anti-human CD2... -
PE/Cyanine5 anti-human CD269 (BCMA)
Human myeloma cell line, U266, was stained with anti-human C... -
PE/Fire™ 810 anti-human CD269 (BCMA)
Human myeloma cell line, U266, was stained with anti-human C... -
Brilliant Violet 650™ anti-human CD269 (BCMA)
U266 cells (a myeloma cell line) were stained with anti-huma... -
Brilliant Violet 785™ anti-human CD269 (BCMA)
U266 cells (a myeloma cell line) were stained with anti-huma... -
Brilliant Violet 605™ anti-human CD269 (BCMA)
U266 cells (a myeloma cell line) were stained with anti-huma... -
TotalSeq™-D0056 anti-human CD269 (BCMA)
Follow Us