Loading...

TotalSeq™-D0062 anti-human CD10 Antibody

Pricing & Availability
Clone
HI10a (See other available formats)
Regulatory Status
RUO
Workshop
V CD10.7
Other Names
Common acute lymphoblastic leukemia antigen (CALLA), Enkephalinase, Neutral endopeptidase, Neprilysin
Isotype
Mouse IgG1, κ
Barcode Sequence
CAGCCATTCATTAGG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
312239 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD10 is a 100 kD neutral endopeptidase and a member of the metalloprotease family. It is a type II transmembrane protein also known as common acute lymphoblastic leukemia antigen (CALLA), enkephalinase, and neprilysin. CD10 is expressed on B cell precursors, T cell precursors, and neutrophils. CD10 is involved in B cell development and has been shown to bind opioid enkephalins, bradykinin, angiotensins I and II, and other biologically active peptides.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Capuchin monkey, Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2892378 (BioLegend Cat. No. 312239)

Antigen Details

Structure
Type II transmembrane metalloprotease family, 100 kD
Distribution

B cell precursors, T cell precursors, neutrophils

Function
Zinc-binding metalloproteinase, B cell development
Ligand/Receptor
Biologically active peptides including opioid enkephalins, bradykinin, angiotensions I & II
Cell Type
B cells, Neutrophils
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Shipp M, et al. 1993. Blood 82:1052.
2. Lu B, et al. 1995. J. Exp. Med. 181:2271.

Gene ID
4311 View all products for this Gene ID
UniProt
View information about CD10 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD10 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD10 HI10a FC,CyTOF®,IHC-F
PE anti-human CD10 HI10a FC
PE/Cyanine5 anti-human CD10 HI10a FC
FITC anti-human CD10 HI10a FC
APC anti-human CD10 HI10a FC
APC/Cyanine7 anti-human CD10 HI10a FC
PE/Cyanine7 anti-human CD10 HI10a FC
PerCP/Cyanine5.5 anti-human CD10 HI10a FC
Brilliant Violet 421™ anti-human CD10 HI10a FC
Brilliant Violet 510™ anti-human CD10 HI10a FC
Brilliant Violet 605™ anti-human CD10 HI10a FC
Purified anti-human CD10 (Maxpar® Ready) HI10a FC,CyTOF®
Brilliant Violet 711™ anti-human CD10 HI10a FC
PE/Dazzle™ 594 anti-human CD10 HI10a FC
APC/Fire™ 750 anti-human CD10 HI10a FC
APC anti-human CD10 HI10a FC
PE anti-human CD10 HI10a FC
FITC anti-human CD10 HI10a FC
TotalSeq™-A0062 anti-human CD10 HI10a PG
TotalSeq™-C0062 anti-human CD10 HI10a PG
APC/Fire™ 750 anti-human CD10 HI10a FC
TotalSeq™-B0062 anti-human CD10 HI10a PG
PE/Cyanine7 anti-human CD10 HI10a FC
PerCP/Cyanine5.5 anti-human CD10 HI10a FC
Brilliant Violet 785™ anti-human CD10 HI10a FC
TotalSeq™-D0062 anti-human CD10 HI10a PG
GMP APC anti-human CD10 HI10a FC
GMP FITC anti-human CD10 HI10a FC
GMP PE/Cyanine7 anti-human CD10 HI10a FC
GMP PE anti-human CD10 HI10a FC
PE/Dazzle™ 594 anti-human CD10 HI10a FC
GMP PerCP/Cyanine5.5 anti-human CD10 HI10a FC
Brilliant Violet 650™ anti-human CD10 HI10a FC
GMP PE/Dazzle™ 594 anti-human CD10 HI10a FC
Brilliant Violet 750™ anti-human CD10 HI10a FC
Spark Violet™ 423 anti-human CD10 HI10a FC
Spark YG™ 593 anti-human CD10 HI10a FC
Spark Blue™ 574 anti-human CD10 HI10a FC
PE/Fire™ 640 anti-human CD10 HI10a FC
Go To Top Version: 1    Revision Date: 05.24.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account